Regulation of endoplasmic reticulum molecular chaperone GRP94 on Pseudorabies virus replication

doi:10.3969/j.issn.1004-1524.2022.11.08

Acta Agriculturae Zhejiangensis ›› 2022, Vol. 34 ›› Issue (11): 2386-2394.DOI: 10.3969/j.issn.1004-1524.2022.11.08

• Animal Science • Previous Articles Next Articles

Regulation of endoplasmic reticulum molecular chaperone GRP94 on Pseudorabies virus replication

NI Minshu¹^,²(), CHEN Li²^,³^,⁴, BAO Xi²^,³^,⁴, XU Yue²^,³^,⁴, ZHUANG Tenghan²^,³^,⁴, FENG Lei¹^,²^,³^,⁴^,^*()

1. School of Pharmacy, Jiangsu University, Zhenjiang 212013, Jiangsu, China
2. Institute of Veterinary Immunology & Engineering, National Research Center of Engineering and Technology for Veterinary Biologicals, Jiangsu Academy of Agricultural Sciences, Nanjing 210014, China
3. Jiangsu Co-Innovation Center for Prevention and Control of Important Animal Infectious Diseases and Zoonoses, Yangzhou 225009, Jiangsu, China
4. Jiangsu Key Laboratory of Food Quality and Safety, State Key Laboratory Cultivation Base Jointly Built by Provinces and Ministries, Nanjing 210014, China

Received:2022-03-07 Online:2022-11-25 Published:2022-11-29
Contact: FENG Lei

Abstract

Abstract:

To explore the effect of glucose-regulated protein 94(GRP94) on Pseudorabies virus(PRV) replication and interaction between GRP94 and PRV structural proteins. BHK-21 cells with GRP94 overexpression were constructed by recombinant lentiviruses transfection and BHK-21 cells with GRP94 coding sequences knockout were constructed by CRISPR/Cas9 system. Progeny PRV titers were measured to compare the changes of virus proliferation efficiency in different cell lines. Western blot was performed to detect the expression level of unfolded protein response (UPR) related proteins in different cell lines. The interaction between virus structural proteins and GRP94 was determined by immunoprecipitation analysis. PRV replication was significantly increased in BHK-21-GRP94 cells, while no significant effect on PRV replication was occurred in BHK-21-GRP94-KO cells. The expression level of GRP78 was significantly up-regulated in BHK-21-GRP94-KO cells and interactions between GRP94 and gB, gD, gI were detected by Co-IP. The overexpression of GRP94 was conducive to the proliferation of PRV. By analyzing UPR related proteins, it was of great significance to study the specific role of GRP94 in the process of virus replication, so as to provide a molecular research basis for PRV and ER stress.

Key words: glucose-regulated protein 94, glucose-regulated protein 78, Pseudorabies virus, protein interaction

CLC Number:

S859.1

NI Minshu, CHEN Li, BAO Xi, XU Yue, ZHUANG Tenghan, FENG Lei. Regulation of endoplasmic reticulum molecular chaperone GRP94 on Pseudorabies virus replication[J]. Acta Agriculturae Zhejiangensis, 2022, 34(11): 2386-2394.

Figures/Tables 9

Table 1 sgRNA sequence

引物Primer	上游引物Forward primer (5'→3')	下游引物Reverse primer(5'→3')
sgRNA-1	CACCTTTGGTCGCCTCTGTACGA	AAACTCGTACAGAGGCGACCAAA
sgRNA-2	CACCAGGAAGACTTGAGATGTGCA	AAACTGCACATCTCAAGTCTTCCT

Fig.1 Morphology of GRP94 overexpressing cell lines A, Fluorescence; B, Natural light.

Fig.2 PCR products of single cell clones Lane 1-6, PCR products from different single cell clones; Lane C, Negative cells.

Fig.3 Comparison of GRP94 gene sequence with PCR product of single cell clones Upper sequence was PCR product sequence of lane C; Lower sequence was PCR product sequence of lane 1.

Fig.4 Detection of GRP94 expression in different BHK-21 cells * and ** meant significant differences at the levels of P<0.1 and P<0.05, respectively. The same as below.

Fig.5 Viral titers of PRV cultured in different cells *** meant significant difference at the level of P<0.001. The same as below.

Fig.6 Expression of UPR related protein in different BHK-21 cells infected with PRV

Fig.7 Immunoprecipitation tests of GRP78, GRP94 and gB, gD, gN, gI

Fig.8 Immunoprecipitation tests of GRP78, GRP94 and gC, gH, gL, gM

References 25

[1]	LUGANINI A, DI NARDO G, MUNARON L, et al. Human Cytomegalovirus US21 protein is a viroporin that modulates calcium homeostasis and protects cells against apoptosis[J]. Proceedings of the National Academy of Sciences of the United States of America, 2018, 115(52): E12370-E12377.
[2]	LI Y, XIA Y C, CHENG X M, et al. Hepatitis B surface antigen activates unfolded protein response in forming ground glass hepatocytes of chronic hepatitis B[J]. Viruses, 2019, 11(4): 386. DOI URL
[3]	WALTER P, RON D. The unfolded protein response: from stress pathway to homeostatic regulation[J]. Science, 2011, 334(6059): 1081-1086. DOI PMID
[4]	BERTOLOTTI A, ZHANG Y H, HENDERSHOT L M, et al. Dynamic interaction of BiP and ER stress transducers in the unfolded-protein response[J]. Nature Cell Biology, 2000, 2(6): 326-332. DOI PMID
[5]	SHEN J S, CHEN X, HENDERSHOT L, et al. ER stress regulation of ATF6 localization by dissociation of BiP/GRP78 binding and unmasking of Golgi localization signals[J]. Developmental Cell, 2002, 3(1): 99-111. DOI PMID
[6]	VAN HUIZEN R, MARTINDALE J L, GOROSPE M, et al. P58IPK, a novel endoplasmic reticulum stress-inducible protein and potential negative regulator of eIF2α signaling[J]. Journal of Biological Chemistry, 2003, 278(18): 15558-15564. DOI URL
[7]	MA Y J, HENDERSHOT L M. Delineation of a negative feedback regulatory loop that controls protein translation during endoplasmic reticulum stress[J]. Journal of Biological Chemistry, 2003, 278(37): 34864-34873. DOI PMID
[8]	LEE A H, IWAKOSHI N N, GLIMCHER L H. XBP-1 regulates a subset of endoplasmic reticulum resident chaperone genes in the unfolded protein response[J]. Molecular and Cellular Biology, 2003, 23(21): 7448-7459. DOI URL
[9]	HARTL F U, MARTIN J. Molecular chaperones in cellular protein folding[J]. Current Opinion in Structural Biology, 1995, 5(1): 92-102. PMID
[10]	ZHOU Y S, QI B Z, GU Y X, et al. Porcine Circovirus 2 deploys PERK pathway and GRP78 for its enhanced replication in PK-15 cells[J]. Viruses, 2016, 8(2): 56. DOI URL
[11]	HE B. Viruses, endoplasmic reticulum stress, and interferon responses[J]. Cell Death & Differentiation, 2006, 13(3): 393-403.
[12]	LEE A S. Mammalian stress response: induction of the glucose-regulated protein family[J]. Current Opinion in Cell Biology, 1992, 4(2): 267-273. PMID
[13]	ZHAO D M, LIU Q T, HAN K K, et al. Identification of glucose-regulated protein 78 (GRP78) as a receptor in BHK-21 cells for duck tembusu virus infection[J]. Frontiers in Microbiology, 2018, 9: 694. DOI PMID
[14]	CHANG S C, ERWIN A E, LEE A S. Glucose-regulated protein (GRP94 and GRP78) genes share common regulatory domains and are coordinately regulated by common trans-acting factors[J]. Molecular and Cellular Biology, 1989, 9(5): 2153-2162. DOI PMID
[15]	HENDERSHOT L M. Immunoglobulin heavy chain and binding protein complexes are dissociated in vivo by light chain addition[J]. The Journal of Cell Biology, 1990, 111(3): 829-837. DOI URL
[16]	ROSE M D, MISRA L M, VOGEL J P. KAR2, a karyogamy gene, is the yeast homolog of the mammalian BiP/GRP78 gene[J]. Cell, 1989, 57(7): 1211-1221. DOI URL
[17]	BRUNEAU N, LOMBARDO D. Chaperone function of a Grp 94-related protein for folding and transport of the pancreatic bile salt-dependent lipase[J]. Journal of Biological Chemistry, 1995, 270(22): 13524-13533. DOI URL
[18]	DORNER A J, KRANE M G, KAUFMAN R J. Reduction of endogenous GRP78 levels improves secretion of a heterologous protein in CHO cells[J]. Molecular and Cellular Biology, 1988, 8(10): 4063-4070. DOI PMID
[19]	DORNER A J, WASLEY L C, KAUFMAN R J. Increased synthesis of secreted proteins induces expression of glucose-regulated proteins in butyrate-treated Chinese hamster ovary cells[J]. Journal of Biological Chemistry, 1989, 264(34): 20602-20607. PMID
[20]	SAMBROOK J F. The involvement of calcium in transport of secretory proteins from the endoplasmic reticulum[J]. Cell, 1990, 61(2): 197-199. PMID
[21]	MARZEC M, ELETTO D, ARGON Y. GRP94: an HSP90-like protein specialized for protein folding and quality control in the endoplasmic reticulum[J]. Biochimica et Biophysica Acta (BBA)-Molecular Cell Research, 2012, 1823(3): 774-787. DOI PMID
[22]	RANDOW F, SEED B. Endoplasmic reticulum chaperone gp96 is required for innate immunity but not cell viability[J]. Nature Cell Biology, 2001, 3(10): 891-896. PMID
[23]	MELNICK J, DUL J L, ARGON Y. Sequential interaction of the chaperones BiP and GRP94 with immunoglobulin chains in the endoplasmic Reticulum[J]. Nature, 1994, 370(6488): 373-375. DOI URL
[24]	MELNICK J, ARGON Y. Molecular chaperones and the biosynthesis of antigen receptors[J]. Immunology Today, 1995, 16(5): 243-250. PMID
[25]	KAPULKIN V, HIESTER B G, LINK C D. Compensatory regulation among ER chaperones in C. elegans[J]. FEBS Letters, 2005, 579(14): 3063-3068. DOI URL

Regulation of endoplasmic reticulum molecular chaperone GRP94 on Pseudorabies virus replication

RichHTML

PDF (PC)

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 9

References 25

Related Articles 4

Recommended Articles

Metrics

Comments

[1]	LI Lei, ZHAO Huajin, WU Zitao, LI Shenghe, JIANG Jinpeng, LIU Chang. Network pharmacological analysis of anti-oxidant mechanism of Cassia semen [J]. , 2020, 32(10): 1855-1865.
[2]	LIU Huijie, XU Heng, QIU Wenyi, LI Xiaofang, ZHANG Hua, ZHU Ying, LI Chunshou, WANG Liangchao. Roles of bZIP transcription factors in plant growth and development and abiotic stress response [J]. , 2019, 31(7): 1205-1214.
[3]	BIAN Jing;XIANG Rong;SUN Li\\|ying;;CHEN Jian\\|ping;. N\\|terminal domain of VPg encoded by Wheat yellow mosaic virus is involved in the interaction with the nucleolar protein Fibrillarin [J]. , 2014, 26(1): 0-94.
[4]	ZHANG Shang\\|lin;SUN Li\\|ying;CHEN Jian\\|ping;*. Interaction between four rice proteins and P7\\|2， an unstructural viral protein encoded by Rice black streaked dwarf virus S7 [J]. , 2013, 25(6): 0-1303.