Construction and biological characteristics of a recombinant pseudorabies virus expressing GP5-M of PRRSV NADC30-like virus strain

doi:10.3969/j.issn.1004-1524.20221629

Acta Agriculturae Zhejiangensis ›› 2023, Vol. 35 ›› Issue (11): 2555-2567.DOI: 10.3969/j.issn.1004-1524.20221629

• Animal Science • Previous Articles Next Articles

Construction and biological characteristics of a recombinant pseudorabies virus expressing GP5-M of PRRSV NADC30-like virus strain

SUN Shanshan¹(), CHEMI Lhamo², LI Qiang¹, ZENG Nanfang³, ZHENG Cheng⁴, ZHANG Baiyu¹, YAN Qigui¹^,^*()

1. College of Veterinary Medicine, Sichuan Agricultural University, Chengdu 611130, China
2. Shangchayu Town Agricultural and Animal Husbandry Comprehensive Center, Zayü County, Zayü 860614, Xizang, China
3. Juxing Agriculture and Animal Husbandry Co., Ltd., Chengdu 611130, China
4. Sichuan Litian Animal Husbandry Co., Ltd., Dazhou 635099, Sichuan, China

Received:2022-11-16 Online:2023-11-25 Published:2023-12-04

Abstract

Abstract:

To obtain a recombinant pseudorabies virus PRV-GP5-M strain that can fuse and express the GP5-M protein of porcine reproductive and respiratory syndrome virus (PRRSV), using the porcine pseudorabies virus (PRV) variant TK gene deletion strain PRV FJ01/TK-as the viral vector and the gI/gE gene as the insertion target, the gI/gE gene was knocked out using homologous recombination technology and CRISPR/Cas9 technology, and a CMV-GP5-M expression box was inserted at the gI/gE position. After plaque purification, a recombinant virus PRV-GP5-M that could correctly express the GP5-M protein was successfully constructed. Furthermore, the biological characteristics of the strain, including stability, growth kinetics, culture characteristics and safety were explored. The results showed that the recombinant strain had good genetic stability, safety, and was easy to proliferate and cultivate. This study result provided new clues for targeting PRRSV GP5 and M protein to generate new PRRSV vaccines, and provided important references for vaccines against the prevalent PRRSV NADC30-like and PRV variant strains in recent years.

Key words: GP5-M protein, recombinant pseudorabies virus, CRISPR/Cas9, biological characteristics

CLC Number:

S855.3

SUN Shanshan, CHEMI Lhamo, LI Qiang, ZENG Nanfang, ZHENG Cheng, ZHANG Baiyu, YAN Qigui. Construction and biological characteristics of a recombinant pseudorabies virus expressing GP5-M of PRRSV NADC30-like virus strain[J]. Acta Agriculturae Zhejiangensis, 2023, 35(11): 2555-2567.

Figures/Tables 17

Table 1 Primers information

引物名称 Primer name	上游引物 Forward primer (5’→3’)	下游引物 Reverse primer (5’→3’)	产物长度 Product length/bp
gI/gE-Left	CCATGATTACGCCAAGCTTTTGCGTACGGCCTTGCTTACGGG	CCGTAATTGATTACTATTAATCGATGGaagcttctacggaccgggct	1 351
gI/gE-eGFP	agcccggtccgtagaagcttCCATCGATTAATAGTAATCAATTACGG	aaacgtgtccatgtcgaaggCCTCTTGTACAGCTCGTCCATGC	1 366
gI/gE-Right	GCATGGACGAGCTGTACAAGAGGccttcgacatggacacgttt	tgtaaaacgacggccagtgaattcGTGCCAGAGCGAGAGCGT	1 402
GP5-M	tgaaccgtcagatccgctagcGCCACCATGCTGGGCAAG	ACGTGTCCATGTCGAAGGCCTTTACTTGGCGTACTTCACCAGGT	1 221

Fig.1 The designs of pUC19-gI/gE/GP5-M vector

Table 2 The primers information of SgRNA

向导RNA SgRNA	上游引物Forward primer(5’→3’)	下游引物Reverse primer(5’→3’)
gI/gE-1	CACCGGTGCACCACGAAGCCTTCCGCGG	AAACCCGCGGAAGGCTTCGTGGTGCACC
gI/gE-2	CACCGGGACGAGTTCAGCAGCGACGAGG	AAACCCTCGTCGCTGCTGAACTCGTCCC

Fig.2 Schematic diagram of constructing recombinant strain

Table 3 Animal experimental scheme

分组 Group		数量 Number	剂量 Dosage/(TCID₅₀·mL^-1)
A(PRV-GP5-M)	A-1	6	10⁴
	A-2	6	10⁵
	A-3	6	10⁶
B(PRV FJ01)	B-1	6	10⁴
	B-2	6	10⁵
	B-3	6	10⁶
C(DMEM)		6	100 μL

Fig.3 PCR amplification of gI/gE transfer vector A, M was DL2000 DNA marker, 1 was gI/gE-Left, 2 was gI/gE-eGFP, 3 was gI/gE-Right. B, M was DL2000 marker, 1 was GP5-M.

Fig.4 Western blot analysis of the GP5-M protein expressed by pUC19-gI/gE/GP5-M M, Protein marker; 1, Transfer vector pUC19-gI/gE/GP5-M.

Fig.5 Detection results of SgRNA vectors M, DL2000 DNA marker,1 and 2 were pX459-gIgE-SgRNA1 and pX459-gIgE-SgRNA2,respectively.

Fig.6 Sequence information of SgRNA vector

Fig.7 Detection results of PRV-GP5-M M, DL5000 DNA marker; 1, PCR result of gI/gE identification primers of PRV FJ01; 2, PCR result of gI/gE identification primers of PRV-GP5-M; 3, Identification result of GP5-M gene primers of PRV-GP5-M.

Fig.8 Western blot analysis of the GP5-M protein expressed by PRV-GP5-M M, Protein marker; 1, PRV-GP5-M; 2, PRV FJ01.

Fig.9 IFA identification of GP5-M protein expressed by PRV-GP5-M A, PRV-GP5-M; B, PRV FJ01.

Fig.10 Genetic stability of recombinant virus A, PCR detection for genetic stability of recombinant virus; M1, DL 2000 DNA maker; F5, F10 and F15 were the GP5-M gene detection results of the 5th, 10th and 15th generations of the recombinant virus PRV-GP5-M, respectively. B, Homology comparison of GP5-M gene in the 5th, 10th and 15th generation. C, The expression of GP5-M protein in recombinant virus PRV-GP5-M was detected by Western blot; M2, Protein marker, F5, F10, F15 were the expression results of the 5th, 10th, 15th generation GP5-M protein in the recombinant virus PRV-GP5-M.

Fig.11 One-step growth curve of PRV-GP5-M and PRV FJ01 strain on PK15

Fig.12 Culture characteristics of recombinant virus in different cells (20×) A, B, C, D, E and F were the culture characteristics of recombinant virus PRV-GP5-M and PRV FJ01 on IPEC, Marc145, MDCK, PK15, ST and Vero, respectively.

Fig.13 TCID50 of recombinant viruses PRV-GP5-M and PRV FJ01 on different cells ****, P <0.001; NS, Not significant. The same as below.

Fig.14 Viral load in different organs A, Standard curve of fluorescent quantitative PCR. B, Melting curve of fluorescent quantitative PCR. C, Virus nucleic acid copy number in different organs, **** indicated P<0.001.

References 26

[1]	ALVAREZ J, VALDES-DONOSO P, TOUSIGNANT S, et al. Novel analytic tools for the study of porcine reproductive and respiratory syndrome virus (PRRSv) in endemic settings: lessons learned in the U.S[J]. Porcine Health Management, 2016, 2(1): 1-9.
[2]	AMONSIN A, KEDKOVID R, PURANAVEJA S, et al. Comparative analysis of complete nucleotide sequence of porcine reproductive and respiratory syndrome virus (PRRSV) isolates in Thailand (US and EU genotypes)[J]. Virology Journal, 2009, 6(1): 1-10.
[3]	WANG H W, CUI X Y, CAI X H, et al. Recombination in positive-strand RNA viruses[J]. Frontiers in Microbiology, 2022, 13: 870759.
[4]	TIAN K G. NADC30-like porcine reproductive and respiratory syndrome in China[J]. The Open Virology Journal, 2017, 11: 59-65.
[5]	BAI X F, WANG Y Z, XU X, et al. Commercial vaccines provide limited protection to NADC30-like PRRSV infection[J]. Vaccine, 2016, 34(46): 5540-5545.
[6]	LI G P, LIU L, XU B J, et al. Displaying epitope B and epitope 7 of porcine reproductive and respiratory syndrome virus on virus like particles of porcine circovirus type 2 provides partial protection to pigs[J]. Journal of Veterinary Medical Science, 2021, 83(8): 1263-1272.
[7]	WEI X, LI R, QIAO S L, et al. Porcine reproductive and respiratory syndrome virus utilizes viral apoptotic mimicry as an alternative pathway to infect host cells[J]. Journal of Virology, 2020, 94(17): e00709.
[8]	REN X F, WANG M C, YIN J C, et al. Heterologous expression of fused genes encoding the glycoprotein 5 from PRRSV: a way for producing functional protein in prokaryotic microorganism[J]. Journal of Biotechnology, 2010, 147(2): 130-135.
[9]	TANG D Y, LIU J, LI C Y, et al. Positive effects of porcine IL-2 and IL-4 on virus-specific immune responses induced by the porcine reproductive and respiratory syndrome virus (PRRSV) ORF5 DNA vaccine in swine[J]. Journal of Veterinary Science, 2014, 15(1): 99-109.
[10]	DOKLAND T. The structural biology of PRRSV[J]. Virus Research, 2010, 154(1/2): 86-97.
[11]	DU L P, YU Z Y, PANG F J, et al. Targeted delivery of GP5 antigen of PRRSV to M cells enhances the antigen-specific systemic and mucosal immune responses[J]. Frontiers in Cellular and Infection Microbiology, 2018, 8: 7.
[12]	ZHANG K S, HUANG J, WANG Q G, et al. Recombinant pseudorabies virus expressing P12A and 3C of FMDV can partially protect piglets against FMDV challenge[J]. Research in Veterinary Science, 2011, 91(1): 90-94.
[13]	ZHANG L, RUAN K, SANG G, et al. TK-deleted pseudorabies virus retains high pathogenicity in rats[J]. Journal of Veterinary Research, 2021, 65(4): 401-405.
[14]	DONG B, ZARLENGA D S, REN X F. An overview of live attenuated recombinant pseudorabies viruses for use as novel vaccines[J]. Journal of Immunology Research, 2014, 2014: 824630.
[15]	TONG W, ZHENG H, LI G X, et al. Recombinant pseudorabies virus expressing E2 of classical swine fever virus (CSFV) protects against both virulent pseudorabies virus and CSFV[J]. Antiviral Research, 2020, 173: 104652.
[16]	CHEN Y, GUO W Z, XU Z W, et al. A novel recombinant pseudorabies virus expressing parvovirus VP2 gene: immunogenicity and protective efficacy in swine[J]. Virology Journal, 2011, 8: 307.
[17]	TIAN Z J, ZHOU G H, ZHENG B L, et al. A recombinant pseudorabies virus encoding the HA gene from H3N2 subtype swine influenza virus protects mice from virulent challenge[J]. Veterinary Immunology and Immunopathology, 2006, 111(3/4): 211-218.
[18]	AN T Q, PENG J M, TIAN Z J, et al. Pseudorabies virus variant in Bartha-K61-vaccinated pigs, China, 2012[J]. Emerging Infectious Diseases, 2013, 19(11): 1749-1755.
[19]	LIU Q Y, WANG X J, XIE C H, et al. A novel human acute encephalitis caused by pseudorabies virus variant strain[J]. Clinical Infectious Diseases, 2021, 73(11): e3690-e3700.
[20]	FENG Z H, CHEN J H, LIANG W, et al. The recombinant pseudorabies virus expressing African swine fever virus CD2v protein is safe and effective in mice[J]. Virology Journal, 2020, 17(1): 180.
[21]	WANG F S, ZUMBRUN E E, HUANG J L, et al. Herpes simplex virus type 2 glycoprotein E is required for efficient virus spread from epithelial cells to neurons and for targeting viral proteins from the neuron cell body into axons[J]. Virology, 2010, 405(2): 269-279.
[22]	LI X, CHEN S, ZHANG L Y, et al. Mutation and interaction analysis of the glycoprotein D and L and thymidine kinase of pseudorabies virus[J]. International Journal of Molecular Sciences, 2022, 23(19): 11597.
[23]	SUN Y Z, ZHAO L, FU Z F. Effective cross-protection of a lyophilized live gE/gI/TK-deleted pseudorabies virus (PRV) vaccine against classical and variant PRV challenges[J]. Veterinary Microbiology, 2022, 267: 109387.
[24]	VIDA F, IRENA O, JERNEJ O, et al. CRISPRa-mediated FOXP3 gene upregulation in mammalian cells[J]. Cell & Bioscience, 2019, 9(1): 93.
[25]	JINEK M, JIANG F G, TAYLOR D W, et al. Structures of Cas9 endonucleases reveal RNA-mediated conformational activation[J]. Science, 2014, 343(6176): 1247997.
[26]	VOYTAS D F, GAO C X. Precision genome engineering and agriculture: opportunities and regulatory challenges[J]. PLoS Biology, 2014, 12(6): e1001877.

Construction and biological characteristics of a recombinant pseudorabies virus expressing GP5-M of PRRSV NADC30-like virus strain

RichHTML

PDF (PC)

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 17

References 26

Related Articles 15

Recommended Articles

Metrics

Comments

[1]	DING Zhaoxue, WANG Jiajie, SHEN Zhonghao, ZHOU Xiaolong, YANG Songbai, JIN Hangfeng, ZHAO Ayong, WANG Han. Construction of PK15 cells with porcine miR-22 upstream sequence mutation [J]. Acta Agriculturae Zhejiangensis, 2022, 34(9): 1849-1855.
[2]	WANG Zhipeng, ZHAO Jian, HUANG Pan, CUI Xuemei, NAN Li, SONG Houhui, BAO Guolian, LIU Yan. Isolation, identification and biological characteristics of rabbit-derived Escherichia coli bacteriophage [J]. Acta Agriculturae Zhejiangensis, 2022, 34(8): 1599-1608.
[3]	OU Chun, ZHANG Min, DING Lin, YAO Xiamei, WANG Zelu, PENG Cheng, XU Junfeng. Application and policy regulation of CRISPR/Cas9 gene editing technology in plants [J]. Acta Agriculturae Zhejiangensis, 2022, 34(8): 1806-1814.
[4]	YANG Ling, SHA Nanjing, PAN Pengju, WU Bozhi. Identification and main biological characteristics of pathogen of Clematis leaf blight in Yunnan [J]. Acta Agriculturae Zhejiangensis, 2022, 34(7): 1449-1456.
[5]	CHEN Runchen, WANG Yining, LIU Xiaowen, WANG Hongyan, DING Qiang, WANG Honglei. Identification, artificial cultivation and nutritional analysis of wild Pholiota adiposa [J]. Acta Agriculturae Zhejiangensis, 2021, 33(12): 2330-2338.
[6]	LI Xuqing, YAN Jianli, RUAN Songlin. Identification and biological characteristics of anthracnose pathogen on Tetrastigma hemsleyanum [J]. , 2020, 32(11): 2009-2019.
[7]	LI Xuqing, ZHANG Jingze, ZHANG Ya, WU Genliang. Identification of pathotype of Verticillium dahlida isolates on eggplant and their biological characteristics in Shaoxing City, Zhejiang Province [J]. , 2019, 31(5): 784-789.
[8]	ZHOU Huiming, ZHANG Yanzhen, CHAI Hongmei, YANG Rongqing, TAN Ying, ZHANG Pingping, BAI Yuying, ZHAO Yilian, JIN Yujie. Identification and culture conditions of a wild-type Termitomyces aurantiacus strain from Lincang [J]. , 2019, 31(10): 1655-1662.
[9]	MA Xiaoping, YANG Qiuxia, YU Yan, LI Desheng, WANG Chengdong, LING Shanshan, GU Yu. Comparison of partial biological characteristics and drug sensitivity between Cladosporium cladosporioides wild strain (Z20) from giant panda and mutant strain (Zt) [J]. , 2018, 30(8): 1328-1335.
[10]	LEI Xueping, GENG Yi, YU Zehui, ZHENG Liping, CAO Shiqi, HUANG Xiaoli, CHEN Defang, OUYANG Ping, LIU Kairui. Isolation and identification of Elizabethkingia meningoseptica from Chinese spiny frog (Quasipaa spinosa) and pathological lesions of its infection [J]. , 2018, 30(3): 371-377.
[11]	MA Xiaoping, YANG Tianyi, ZHANG Zhihe, YU Yan, WANG Chengdong, GU Yu. Study on biological characteristics of Lactobacillus from giant panda vagina [J]. , 2017, 29(7): 1093-1102.
[12]	YUAN Wenxia, WANG Xuming, LI Dongyue, ZHOU Jie, YAN Chengqi, CHEN Jianping. Application of the technology of CRISPR/Cas9 edit rice gene [J]. , 2017, 29(5): 685-693.
[13]	SHEN Chunxiu. CRISPR/Cas9 editing and expression analysis of LOC_Os10g05490 in rice under cold stress [J]. , 2017, 29(2): 177-185.
[14]	LI Jing\\|jing， DING Song\\|shuang， LI Yan\\|ping， YUN Fei， YAN Hai\\|tao， WANG Zhi\\|meng， LIU Guo\\|shun*. Effects of biochar and nitrogen fertilizers on dry matter accumulation of flue\\|cured tobacco and soil biological characteristics [J]. , 2016, 28(1): 96-.
[15]	LI Xu\\|qing1， TIAN Zhong\\|ling2， ZHENG Ji\\|rong1， ZHENG Jing\\|wu2. Biological characteristics and fungicide screening of Stemphylium lycopersici causing tomato grey leaf spot [J]. , 2015, 27(11): 1953-.