The molecular mechanism of inhibition of butyric acid to inhibit porcine epidemic diarrhea virus replication in vitro

doi:10.3969/j.issn.1004-1524.20240224

Acta Agriculturae Zhejiangensis ›› 2025, Vol. 37 ›› Issue (3): 579-590.DOI: 10.3969/j.issn.1004-1524.20240224

• Animal Science • Previous Articles Next Articles

The molecular mechanism of inhibition of butyric acid to inhibit porcine epidemic diarrhea virus replication in vitro

ZHANG Chuni¹(), XU Jidong¹^,², GAO Qin¹, SHAN Ying¹^,², FANG Weihuan¹^,², LI Xiaoliang¹^,²^,^*()

1. Zhejiang Province Key Laboratory of Veterinary Medicine, MOA Key Laboratory of Animal Virology, College of Animal Sciences, Zhejiang University, Hangzhou 310058, China
2. ZJU-Xinchang Joint Innovation Centre (Tianmu Laboratory), Xinchang 312532, Zhejiang, China

Received:2024-03-08 Online:2025-03-25 Published:2025-04-02

Abstract

Abstract:

Porcine epidemic diarrhea virus (PEDV) is a coronavirus that causes highly contagious acute intestinal infectious diseases and seriously threatens the healthy development of pig industry. Butyric acid, as a feed additive, is widely used in pig farming. It not only serves as an energy source but also participates in regulating gene expression, anti-inflammatory responses, cell cycle and other vital movements. However, the mechanism of butyric acid in PEDV infection remains unclear. This study aims to investigate the inhibitory effect of butyric acid on PEDV replication and its underlying mechanisms. Using techniques such as real-time fluorescent quantitative PCR (qRT-PCR), Western blot, and immunofluorescence, the impact of butyric acid treatment on PEDV replication was assessed. Additionally, cell cycle-related protein expression analysis and flow cytometry were used to study the effects of PEDV infection on the cell cycle and the regulatory role of butyric acid. The results demonstrated that butyric acid treatment significantly inhibited PEDV replication in IPEC-J2 cells. PEDV infection upregulated the expression of the cell cycle-related protein Cyclin A2 and induced S-phase (DNA synthesis phase) arrest to facilitate its own replication. Butyric acid alleviated PEDV-induced S-phase arrest by downregulating Cyclin A2 expression, thereby exerting its antiviral effects. In conclusion, butyric acid inhibits viral replication by modulating the cell cycle and mitigating PEDV-induced S-phase arrest. This study provides a theoretical basis for the application of butyric acid as an antiviral strategy in animal production.

Key words: porcine epidemic diarrhea virus, butyric acid, cell cycle, Cyclin A2, S-phase cell cycle arrest, antiviral effect, IPEC-J2 cell

CLC Number:

S855.3

ZHANG Chuni, XU Jidong, GAO Qin, SHAN Ying, FANG Weihuan, LI Xiaoliang. The molecular mechanism of inhibition of butyric acid to inhibit porcine epidemic diarrhea virus replication in vitro[J]. Acta Agriculturae Zhejiangensis, 2025, 37(3): 579-590.

Figures/Tables 5

Table 1 The sequences of primers

基因Gene	正向引物序列Forward primer sequence (5'→3')	反向引物序列Reverse primer sequence(5'→3')
PEDV N	CGGAACAGGACCTCACGCC	ACAATCTCAACTACGCTGGGAAG
GAPDH	CACTGAGGACCAGGTTGTGTCCTGTGAC	TCCACCACCCTGTTGCTGTAGCCAAATTC

Fig.1 BA inhibited PEDV replication in IPEC-J2 cells A, CCK-8 assay was used to detect cell activity; B and C, Western blotting and densitometric analysis of PEDV-N/β-actin ratio; D, mRNA levels were detected by qRT-PCR; E, 50% tissue culture infective dose; F, Immunofluorescence analysis. Data were expressed as the mean ±standard deviation of three independent experiments; ns, The difference was not significant; **, P<0.01; ***, P<0.001. The ‘+’ represented PEDV infection, while the ‘-’ represented Mock infection or treatment without adding butyric acid.

Fig.2 The regulation of cell cycle-related protein expression by BA A and B, PEDV-infected IPEC-J2 cells were treated with 3 mmol·L-1 BA, followed by the addition of 1 μmol·L-1 proteasome inhibitor MG132, after 24 hours, the cells were harvested, and total protein was extracted, Western blot was used to detect the levels of PEDV N protein and H3K9 acetylation, while qRT-PCR was employed to measure the transcriptional level of the PEDV N gene. C, PEDV-infected IPEC-J2 cells were treated with 3 mmol·L-1 BA, after 24 hours, the cells were harvested, and total protein was extracted, Western blot was used to assess the phosphorylation level of the endoplasmic reticulum stress-related protein PERK. D, PEDV-infected IPEC-J2 cells were treated with either 3 mmol·L-1 BA or NaB, after 24 hours, the cells were harvested, and total protein was extracted, Western blot was used to detect cell cycle-related proteins. The ‘+’ represented inhibitor treatment/PEDV infection, while the ‘-’ represented an equivalent amount of DMSO treatment/Mock infection. ns, The difference was not significant; ***, P<0.001.

Fig.3 PEDV induced cell cycle arrest in S-phase A, Expression of cell cycle-related proteins at different time post-PEDV infection; B, Cell cycle analysis by flow cytometry; C, Statistical analysis of flow cytometry results; D, The impact of S-phase inhibitors on the expression of PEDV N protein. The ‘+’ represented inhibitor treatment/PEDV infection, while the ‘-’ represented an equivalent amount of DMSO treatment/Mock infection. *, P<0.05; **, P<0.01.

Fig.4 BA mitigated PEDV-induced S-phase arrest of cell cycle A, The effect of BA on the expression of cell cycle-related proteins; B, Statistical analysis; C, Cell cycle was detected by flow cytometry. The ‘+’ represented PEDV infection, while the ‘-’ represented Mock infection or treatment without adding butyric acid.

References 45

[1]	GIOTI K, KOTTARIDI C, VOYIATZAKI C, et al. Animal coronaviruses induced apoptosis[J]. Life, 2021, 11(3): 185.
[2]	YANG K M, JIANG Z Y, ZHENG C T, et al. Effect of Lactobacillus plantarum on diarrhea and intestinal barrier function of young piglets challenged with enterotoxigenic Escherichia coli K88[J]. Journal of Animal Science, 2014, 92(4): 1496-1503.
[3]	JUNG K, SAIF L J. Porcine epidemic diarrhea virus infection: etiology, epidemiology, pathogenesis and immunoprophylaxis[J]. Veterinary Journal, 2015, 204(2): 134-143.
[4]	LEE S, KIM Y, LEE C. Isolation and characterization of a Korean porcine epidemic diarrhea virus strain KNU-141112[J]. Virus Research, 2015, 208: 215-224.
[5]	WANG X M, NIU B B, YAN H, et al. Genetic properties of endemic Chinese porcine epidemic diarrhea virus strains isolated since 2010[J]. Archives of Virology, 2013, 158(12): 2487-2494.
[6]	OH C, KIM Y, CHANG K O. Caspase-mediated cleavage of nucleocapsid protein of a protease-independent porcine epidemic diarrhea virus strain[J]. Virus Research, 2020, 285: 198026.
[7]	WANG H, CHEN X Y, KONG N, et al. TRIM21 inhibits porcine epidemic diarrhea virus proliferation by proteasomal degradation of the nucleocapsid protein[J]. Archives of Virology, 2021, 166(7): 1903-1911.
[8]	ZHANG Q Z, SHI K C, YOO D. Suppression of type I interferon production by porcine epidemic diarrhea virus and degradation of CREB-binding protein by nsp1[J]. Virology, 2016, 489: 252-268.
[9]	DING Z, FANG L R, JING H Y, et al. Porcine epidemic diarrhea virus nucleocapsid protein antagonizes beta interferon production by sequestering the interaction between IRF3 and TBK1[J]. Journal of Virology, 2014, 88(16): 8936-8945.
[10]	JIAO Y J, KONG N, WANG H, et al. PABPC4 broadly inhibits coronavirus replication by degrading nucleocapsid protein through selective autophagy[J]. Microbiology Spectrum, 2021, 9(2): e0090821.
[11]	NEUNLIST M, VAN LANDEGHEM L, MAHÉ M M, et al. The digestive neuronal-glial-epithelial unit: a new actor in gut health and disease[J]. Nature Reviews Gastroenterology & Hepatology, 2013, 10(2): 90-100.
[12]	BRANDTZAEG P. The gut as communicator between environment and host: immunological consequences[J]. European Journal of Pharmacology, 2011, 668(Suppl 1): S16-S32.
[13]	HUANG C, SONG P X, FAN P X, et al. Dietary sodium butyrate decreases postweaning diarrhea by modulating intestinal permeability and changing the bacterial communities in weaned Piglets1-3[J]. The Journal of Nutrition, 2015, 145(12): 2774-2780.
[14]	LIU W H, LA A L T Z, EVANS A, et al. Supplementation with sodium butyrate improves growth and antioxidant function in dairy calves before weaning[J]. Journal of Animal Science and Biotechnology, 2021, 12(1): 2.
[15]	WANG X K, HE G, PENG Y, et al. Sodium butyrate alleviates adipocyte inflammation by inhibiting NLRP3 pathway[J]. Scientific Reports, 2015, 5: 12676.
[16]	FANG C L, SUN H, WU J, et al. Effects of sodium butyrate on growth performance, haematological and immunological characteristics of weanling piglets[J]. Journal of Animal Physiology and Animal Nutrition, 2014, 98(4): 680-685.
[17]	YANG X, ZHUANG J, WU W, et al. Inhibitory effect of sodium butyrate on colorectal cancer cells and construction of the related molecular network[J]. BMC Cancer, 2021, 21(1): 127.
[18]	YAN H, AJUWON K M. Butyrate modifies intestinal barrier function in IPEC-J2 cells through a selective upregulation of tight junction proteins and activation of the Akt signaling pathway[J]. PLoS One, 2017, 12(6): e0179586.
[19]	CHEN G X, RAN X, LI B, et al. Sodium butyrate inhibits inflammation and maintains epithelium barrier integrity in a TNBS-induced inflammatory bowel disease mice model[J]. eBioMedicine, 2018, 30: 317-325.
[20]	APRAIZ A, MITXELENA J, ZUBIAGA A. Studying cell cycle-regulated gene expression by two complementary cell synchronization protocols[J]. Journal of Visualized Experiments, 2017(124): 55745.
[21]	XU P, ZHOU Z, XIONG M, et al. Parvovirus B19 NS1 protein induces cell cycle arrest at G2-phase by activating the ATR-CDC25C-CDK1 pathway[J]. PLoS Pathogens, 2017, 13(3): e1006266.
[22]	SU M J, SHI D, XING X X, et al. Coronavirus porcine epidemic diarrhea virus nucleocapsid protein interacts with p53 to induce cell cycle arrest in S-phase and promotes viral replication[J]. Journal of Virology, 2021, 95(16): e0018721.
[23]	KUMAR A, WU H X, COLLIER-HYAMS L S, et al. The bacterial fermentation product butyrate influences epithelial signaling via reactive oxygen species-mediated changes in cullin-1 neddylation[J]. Journal of Immunology, 2009, 182(1): 538-546.
[24]	ZHAO Y, HU N M, JIANG Q, et al. Protective effects of sodium butyrate on rotavirus inducing endoplasmic reticulum stress-mediated apoptosis via PERK-eIF2α signaling pathway in IPEC-J2 cells[J]. Journal of Animal Science and Biotechnology, 2021, 12(1): 69.
[25]	MATTHEWS H K, BERTOLI C, DE BRUIN R A M. Cell cycle control in cancer[J]. Nature Reviews Molecular Cell Biology, 2022, 23(1): 74-88.
[26]	ZHANG S Y, TISCHER T, BARFORD D. Cyclin A2 degradation during the spindle assembly checkpoint requires multiple binding modes to the APC/C[J]. Nature Communications, 2019, 10(1): 3863.
[27]	SUI L Y, LI L T, ZHAO Y H, et al. Host cell cycle checkpoint as antiviral target for SARS-CoV-2 revealed by integrative transcriptome and proteome analyses[J]. Signal Transduction and Targeted Therapy, 2023, 8(1): 21.
[28]	SUN W, SUN J, LI M, et al. The effects of dietary sodium butyrate supplementation on the growth performance, carcass traits and intestinal microbiota of growing-finishing pigs[J]. Journal of Applied Microbiology, 2020, 128(6): 1613-1623.
[29]	LI W X, LAN T Y, DING Q, et al. Effect of low protein diets supplemented with sodium butyrate, medium-chain fatty acids, or n-3 polyunsaturated fatty acids on the growth performance, immune function, and microbiome of weaned piglets[J]. International Journal of Molecular Sciences, 2023, 24(24): 17592.
[30]	HAAK B W, LITTMANN E R, CHAUBARD J L, et al. Impact of gut colonization with butyrate-producing microbiota on respiratory viral infection following allo-HCT[J]. Blood, 2018, 131(26): 2978-2986.
[31]	POELAERT K C K, VAN CLEEMPUT J, LAVAL K, et al. Beyond gut instinct: metabolic short-chain fatty acids moderate the pathogenesis of alphaherpesviruses[J]. Frontiers in Microbiology, 2019, 10: 723.
[32]	LI J, RICHARDS E M, HANDBERG E M, et al. Butyrate regulates COVID-19-relevant genes in gut epithelial organoids from normotensive rats[J]. Hypertension, 2021, 77(2): e13-e16.
[33]	IMAI K, OKAMOTO T, OCHIAI K. Involvement of Sp1 in butyric acid-induced HIV-1 gene expression[J]. Cellular Physiology and Biochemistry, 2015, 37(3): 853-865.
[34]	CHEN D F, JIN D C, HUANG S M, et al. Clostridium butyricum, a butyrate-producing probiotic, inhibits intestinal tumor development through modulating Wnt signaling and gut microbiota[J]. Cancer Letters, 2020, 469: 456-467.
[35]	THANGARAJU M, CRESCI G A, LIU K B, et al. GPR109A is a G-protein-coupled receptor for the bacterial fermentation product butyrate and functions as a tumor suppressor in colon[J]. Cancer Research, 2009, 69(7): 2826-2832.
[36]	PATTAYIL L, BALAKRISHNAN-SARASWATHI H T. In vitro evaluation of apoptotic induction of butyric acid derivatives in colorectal carcinoma cells[J]. Anticancer Research, 2019, 39(7): 3795-3801.
[37]	PANT K, MISHRA A K, PRADHAN S M, et al. Butyrate inhibits HBV replication and HBV-induced hepatoma cell proliferation via modulating SIRT-1/Ac-p53 regulatory axis[J]. Molecular Carcinogenesis, 2019, 58(4): 524-532.
[38]	GIL-RANEDO J, HERNANDO E, RIOLOBOS L, et al. The mammalian cell cycle regulates parvovirus nuclear capsid assembly[J]. PLoS Pathogens, 2015, 11(6): e1004920.
[39]	SULLIVAN C S, PIPAS J M. T antigens of Simian virus 40: molecular chaperones for viral replication and tumorigenesis[J]. Microbiology and Molecular Biology Reviews, 2002, 66(2): 179-202.
[40]	ZHU L, ZHAO W M, LU J, et al. Influenza virus matrix protein M1 interacts with SLD5 to block host cell cycle[J]. Cellular Microbiology, 2019, 21(8): e13038.
[41]	MASENGA S K, MWEENE B C, LUWAYA E, et al. HIV-host cell interactions[J]. Cells, 2023, 12(10): 1351.
[42]	DREMEL S E, JIMENEZ A R, TUCKER J M. “Transfer” of power: the intersection of DNA virus infection and tRNA biology[J]. Seminars in Cell & Developmental Biology, 2023, 146: 31-39.
[43]	XU X G, ZHANG H L, ZHANG Q, et al. Porcine epidemic diarrhea virus N protein prolongs S-phase cell cycle, induces endoplasmic reticulum stress, and up-regulates interleukin-8 expression[J]. Veterinary Microbiology, 2013, 164(3/4): 212-221.
[44]	XU X G, ZHANG H L, ZHANG Q, et al. Porcine epidemic diarrhea virus M protein blocks cell cycle progression at S-phase and its subcellular localization in the porcine intestinal epithelial cells[J]. Acta Virologica, 2015, 59(3): 265-275.
[45]	YANG J W, TIAN G, CHEN D W, et al. 1, 25-Dihydroxyvitamin D3 inhibits porcine epidemic diarrhea virus replication by regulating cell cycle resumption in IPEC-J2 porcine epithelial cells[J]. Microbial Pathogenesis, 2021, 158: 105017.

The molecular mechanism of inhibition of butyric acid to inhibit porcine epidemic diarrhea virus replication in vitro

RichHTML

PDF (PC)

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 5

References 45

Related Articles 9

Recommended Articles

Metrics

Comments

[1]	ZHENG Yuanyua, YU Zheping, ZHANG Shuwen, LI Yougui, SUN Li, ZHENG Xiliang, QI Xingjiang. Effect of alcohol extracts from Chinese bayberry branch on proliferation and apoptosis of A375 cells and its molecular mechanism [J]. Acta Agriculturae Zhejiangensis, 2022, 34(5): 974-983.
[2]	GUO Fucheng, JIN Li, SU Qiang, SU Yuxin, LI Fanglin, CHEN Shien, MA Xiaoxia. Prokaryotic expression and purification of PEDV N protein and analysis of B cell antigen epitope [J]. , 2020, 32(5): 762-769.
[3]	DEXI Cuomu, WANG Yin, YANG Zexiao, YAO Xueping, LUO Yan, LIAO Changyu, ZHANG Pengfei, JIANG Dike, XIANG Mingyuan, JIANG Ruijiao, SONG Yong. Epidemiological investigation of porcine epidemic diarrhea virus and sequence analysis of ORF3 and S1 genes in Sichuan from 2016 to 2018 [J]. , 2019, 31(9): 1423-1428.
[4]	LIU Zhengkui, WU Yuan, CHEN Lin, WANG Lei, MU Hongye, ZHU Xuhang, WANG Xiaodu. Prokaryotic expression and bioinformatics analysis of Nsp5 gene of porcine epidemic diarrhea virus [J]. , 2019, 31(4): 532-538.
[5]	DONG Bo, AN Yongshuai, DAI Ailing, LI Xiaohua, YANG Xiaoyan. Evolutionary and molecular characteristics of M genes of porcine epidemic diarrhea viruses in western Fujian, China [J]. , 2018, 30(6): 939-945.
[6]	GONG Shuangyan, LI Xiaojing, CHEN Yingqi, CAI Yao, LI Yumeng, XU Yifei, ZHU Ling, XU Zhiwen. Establishment of a multiplex PCR for porcine epidemic diarrhea virus and porcine circovirus type 2 [J]. , 2017, 29(7): 1086-1092.
[7]	WU Wangxia1, WANG Yicheng2, WU Run, YUAN Xiufang, XU Lihua, LI Junxing, SU Fei. Genetic analysis of S and ORF3 gene in Porcihe epidemic diarrhea virus during 2011—2016 in Zhejiang Province [J]. , 2017, 29(3): 380-388.
[8]	XU Yuqin1， DAI Xixi1， TANG Huiqin1， GU Xiaoxiao1， PAN Kangcheng 1， 2， *. Screening of γaminobutyric acidproducing probiotics and characterization of its biological activity [J]. , 2016, 28(3): 502-.
[9]	LIU Su\\|jun， DUAN Song\\|huan， HU Jing\\|yan， JIN Jun\\|jie， TU Yi\\|qiang， BAI Yu*. Preparation and identification of monoclonal antibodies against the nucleocapsid protein of porcine epidemic diarrhea virus [J]. , 2015, 27(6): 950-.