Effects of MitoQ on mitochondrial function and antioxidant capacity of canine bone marrow mesenchymal stem cells

doi:10.3969/j.issn.1004-1524.2022.05.07

Acta Agriculturae Zhejiangensis ›› 2022, Vol. 34 ›› Issue (5): 934-941.DOI: 10.3969/j.issn.1004-1524.2022.05.07

• Animal Science • Previous Articles Next Articles

Effects of MitoQ on mitochondrial function and antioxidant capacity of canine bone marrow mesenchymal stem cells

ZHONG Lijun(), DENG Jiaqiang, GU Congwei, SHEN Liuhong, CAO Suizhong, YU Shumin()

College of Veterinary Medicine,Sichuan Agricultural University,Chengdu 611130,China

Received:2021-01-18 Online:2022-05-25 Published:2022-06-06
Contact: YU Shumin

Abstract

Abstract:

The aim of this study was to investigate the effect of Mitoquinone (MitoQ), a mitochondrial-targeted antioxidant, on the mitochondrial function and antioxidant gene expression of canine bone marrow mesenchymal stem cells (BMSCs), which may provide a theoretical basis for improving the clinical application efficiency of canine BMSCs. Canine BMSCs treated with MitoQ for 48 h were used as materials to evaluate the mitochondrial function and the expression level of antioxidant genes.The results showed that with the increase of passage times,the mitochondrial fusion of BMSCs was significantly advanced, and mitochondrial division was significantly weakened. In addition, the mitochondrial membrane potential and ATP content were significantly decreased and the expression of antioxidant genes of BMSCs was also significantly down-regulated.After MitoQ pretreatment, the expression of BMSCs mitochondrial fusion gene Mfn2 was slightly up-regulated, and the expression of mitochondrial division gene Drp1 and mitochondrial biosynthesis-related gene PGC-1α were significantly up-regulated. More over, the mitochondrial membrane potential and ATP content increased significantly and the expression of antioxidant genes SOD1, SOD2, CAT and GSH-Px was significantly up-regulated.In summary, MitoQ can improve the mitochondrial function and enhance the antioxidant capacity of canine BMSCs.

Key words: canine, mitochondria, oxidative stress

CLC Number:

S829.2

ZHONG Lijun, DENG Jiaqiang, GU Congwei, SHEN Liuhong, CAO Suizhong, YU Shumin. Effects of MitoQ on mitochondrial function and antioxidant capacity of canine bone marrow mesenchymal stem cells[J]. Acta Agriculturae Zhejiangensis, 2022, 34(5): 934-941.

Figures/Tables 6

Table 1 Primer parameters

基因名称Gene ID	上游引物Forward primer (5'→3')	下游引物Reverse primer (5'→3')	长度Length/bp
SOD2	CTCAAGTTCAATGGAGGAGGTCA	CTTGGACACCGACGGATACAG	169
SOD1	CATTACAGGGCTGACTGAAGGC	TTGGACAGAGGATTAAAGTGAGGA	105
CAT	GATACCTGTGAACTGTCCTT	CATTGGCTGCTATGCTCTA	109
GSH-Px	CAACCAGTTCGGGCATCA	CGTTCACCTCGCACTTCTCA	122
Drp1	TAGAAATGCTACTGGTCCTCGTCC	CAGTTCCACACAACGCAGGC	115
Fis1	GTCTGTGGACGACCTGCTGAA	TGCGATGCCTTTACGGATG	142
Mfn2	GGCCTTGATGGGCTACAATGAC	CGCCTCCGACAACGAGAATG	179
Mfn1	CAGGGCGGTTACAGAAGAGGT	CAATACGCTTGGAGTGGGATGA	121
Opa1	GCAGAATCCTAACGCCATCATAC	ACAAATATCGTCCTCCTTCCATG	117
PGC-1α	TTCGGTCATCCCAGTCAAGC	TGTCATCAAACAGGCCATCCA	145
GAPDH	TCCCGCCAACATCAAA	TCACGCCCATCACAAAC	163

Fig.1 Effects of in vitro expansion on morphology of BMSCs A-C represented the morphology of P1, P3 and P6 BMSCs (scale bar=100 μm).

Fig.2 Identification of BMSCs A-F represented the immunofluorescence detection results of cell surface markers CD105, CD90, CD31 and negative control (scale bar=200 μm) and the results of staining after osteogenic differentiation and adipogenic differentiation of BMSCs (scale bar=100 μm).

Fig.3 Effects of in vitro expansion on antioxidant gene expression and mitochondrial function of BMSCs A-F represented the relative expression of SOD1, SOD2, CAT, GSH-Px, PGC-1α, Opa1,Mfn1, Mfn2, Fis1and Drp1,mitochondrial membrane potential level(scale bar=100 μm) and ATP content of BMSCs, respectively. * and **,Significant difference at P<0.05 and P<0.01. ns, No significance. The same as below.

Fig.4 Effects of MitoQ on the expression of BMSCs antioxidant genes and mitochondrial dynamics-related genes

Fig.5 Effects of MitoQ on mitochondrial membrane potential and ATP content of BMSCs A and B represented the mitochondrial membrane potential level (scale bar=100 μm) and ATP content of BMSCs after MitoQ treatment.

References 21

[1]	WANG Y H, WANG D R, GUO Y C, et al. The application of bone marrow mesenchymal stem cells and biomaterials in skeletal muscle regeneration[J]. Regenerative Therapy, 2020, 15: 285-294. DOI URL
[2]	DRELA K, STANASZEK L, NOWAKOWSKI A, et al. Experimental strategies of mesenchymal stem cell propagation: adverse events and potential risk of functional changes[J]. Stem Cells International, 2019, 2019: 7012692.
[3]	ZHANG F, PENG W X, ZHANG J, et al. New strategy of bone marrow mesenchymal stem cells against oxidative stress injury via Nrf2 pathway: oxidative stress preconditioning[J]. Journal of Cellular Biochemistry, 2019, 120(12): 19902-19914. DOI URL
[4]	CHEN X J, WANG L, SONG X Y. Mitoquinone alleviates vincristine-induced neuropathic pain through inhibiting oxidative stress and apoptosis via the improvement of mitochondrial dysfunction[J]. Biomedicine & Pharmacotherapy, 2020, 125: 110003. DOI URL
[5]	PLECITÁ-HLAVATÁ L, JEŽEK J, JEŽEK P. Pro-oxidant mitochondrial matrix-targeted ubiquinone MitoQ10 Acts as anti-oxidant at retarded electron transport or proton pumping within Complex I[J]. The International Journal of Biochemistry & Cell Biology, 2009, 41(8/9): 1697-1707. DOI URL
[6]	APOSTOLOVA N, GARCIA-BOU R, HERNANDEZ-MIJARES A, et al. Mitochondrial antioxidants alleviate oxidative and nitrosative stress in a cellular model of Sepsis[J]. Pharmaceutical Research, 2011, 28(11): 2910-2919. DOI URL
[7]	ZHANG J, BAO X W, ZHANG M Y, et al. MitoQ ameliorates testis injury from oxidative attack by repairing mitochondria and promoting the Keap1-Nrf2 pathway[J]. Toxicology and Applied Pharmacology, 2019, 370: 78-92. DOI URL
[8]	TURINETTO V, VITALE E, GIACHINO C. Senescence in human mesenchymal stem cells: functional changes and implications in stem cell-based therapy[J]. International Journal of Molecular Sciences, 2016, 17(7): 1164. DOI URL
[9]	STAB B R, MARTINEZ L, GRISMALDO A, et al. Mitochondrial functional changes characterization in young and senescent human adipose derived MSCs[J]. Frontiers in Aging Neuroscience, 2016, 8: 299.
[10]	SEOK J, JUNG H S, PARK S, et al. Alteration of fatty acid oxidation by increased CPT1A on replicative senescence of placenta-derived mesenchymal stem cells[J]. Stem Cell Research & Therapy, 2020, 11(1): 1-13.
[11]	LI X, HONG Y M, HE H W, et al. FGF21 mediates mesenchymal stem cell senescence via regulation of mitochondrial dynamics[J]. Oxidative Medicine and Cellular Longevity, 2019, 2019: 4915149.
[12]	LEE J H, YOON Y M, SONG K H, et al. Melatonin suppresses senescence-derived mitochondrial dysfunction in mesenchymal stem cells via the HSPA1L-mitophagy pathway[J]. Aging Cell, 2020, 19(3): e13111.
[13]	YANG F, YAN G G, LI Y, et al. Astragalus polysaccharide attenuated iron overload-induced dysfunction of mesenchymal stem cells via suppressing mitochondrial ROS[J]. Cellular Physiology and Biochemistry, 2016, 39(4): 1369-1379. DOI URL
[14]	YOON Y M, KIM S, HAN Y S, et al. TUDCA-treated chronic kidney disease-derived hMSCs improve therapeutic efficacy in ischemic disease via PrPC[J]. Redox Biology, 2019, 22: 101144. DOI URL
[15]	LI X, ZHAN J H, HOU Y, et al. Coenzyme Q10 regulation of apoptosis and oxidative stress in H₂O₂ induced BMSC death by modulating the nrf-2/NQO-1 signaling pathway and its application in a model of spinal cord injury[J]. Oxidative Medicine and Cellular Longevity, 2019, 2019: 6493081.
[16]	ZHANG D Y, YAN B X, YU S S, et al. Coenzyme Q10 inhibits the aging of mesenchymal stem cells induced by D-galactose through Akt/mTOR signaling[J]. Oxidative Medicine and Cellular Longevity, 2015, 2015: 867293.
[17]	TAN D Q, SUDA T. Reactive oxygen species and mitochondrial homeostasis as regulators of stem cell fate and function[J]. Antioxidants & Redox Signaling, 2018, 29(2): 149-168.
[18]	ESCRIBANO-LOPEZ I, BAÑULS C, DIAZ-MORALES N, et al. The mitochondria-targeted antioxidant MitoQ modulates mitochondrial function and endoplasmic Reticulum stress in pancreatic β cells exposed to hyperglycaemia[J]. Cellular Physiology and Biochemistry, 2019, 52(2): 186-197. DOI URL
[19]	RAMSEY H, ZHANG Q, WU M X. Mitoquinone restores platelet production in irradiation-induced thrombocytopenia[J]. Platelets, 2015, 26(5): 459-466. DOI URL
[20]	KANG L, LIU S W, LI J C, et al. The mitochondria-targeted anti-oxidant MitoQ protects against intervertebral disc degeneration by ameliorating mitochondrial dysfunction and redox imbalance[J]. Cell Proliferation, 2020, 53(3): e12779.
[21]	ZHOU J, WANG H D, SHEN R M, et al. Mitochondrial-targeted antioxidant MitoQ provides neuroprotection and reduces neuronal apoptosis in experimental traumatic brain injury possibly via the Nrf2-ARE pathway[J]. American Journal of Translational Research, 2018, 10(6): 1887-1899.

Effects of MitoQ on mitochondrial function and antioxidant capacity of canine bone marrow mesenchymal stem cells

RichHTML

PDF (PC)

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 6

References 21

Related Articles 15

Recommended Articles

Metrics

Comments

[1]	XIONG Xinyi, XU Zeyu, HE Nianjia, HE Junbo, CHEN Zhengli, HUANG Chao, LIU Wentao, LUO Qihui. Effects of soy isoflavones on oxidative stress and inflammatory response in liver of rats with food borne obesity [J]. Acta Agriculturae Zhejiangensis, 2022, 34(5): 942-948.
[2]	JI Kaiyuan, QIU Yueyang, CHENG Ao, JIANG Shudong, PENG Mengling. Genetic diversity of Canine parvovirus in Hefei, Anhui Province from 2018 to 2019 [J]. Acta Agriculturae Zhejiangensis, 2021, 33(10): 1817-1825.
[3]	LIU Kai, FENG Xiaoyu, MA Hengjia, XIE Nan. Complete sequence and gene organization of mitochondrial genome of Megalobrama terminalis from Qiantang River [J]. , 2020, 32(9): 1591-1608.
[4]	YUE Jianhua, DONG Yan, LI Wenyang, LI Meng, ZHANG Yan. Effects of pH on physiological characters in somatic embryo induction stage of Agapanthus praecox [J]. , 2020, 32(8): 1405-1414.
[5]	YANG Mingxia, LIAN Hongjuan, WANG Xiaofang, DU Yiyang, DONG Zhigang, JI Wei. Identification and expression analysis of grape MPT gene family [J]. Acta Agriculturae Zhejiangensis, 2020, 32(12): 2173-2185.
[6]	MA Qixue, SUN Xiangyang, LI Suyan, LI Song, LIU Yuanxin, ZHOU Wenjie. Effects of applying green waste compost on physiological characteristics of pakchoi in Pb, Zn contaminated soil [J]. , 2020, 32(11): 2027-2034.
[7]	YUAN Donghao, YANG Tianyan, MENG Wei, ZHENG Yao, ZHENG Deyu. Sequence variation and molecular phylogeny of mitochondrial Cyt b gene segments from four Sillago species [J]. , 2020, 32(1): 35-42.
[8]	YIN Xiaoxiao, LI Yanfang, GU Jiang, LIAO Yan, XIE Yue, YANG Guangyou, GU Xiaobin. Genetic diversity analysis of Psoroptes ovis var. cuniculi by full-length of mitochondrial ATP6 gene in China [J]. , 2019, 31(8): 1231-1238.
[9]	YANG Zongying, ZHANG Yiliu, HU Kun, YANG Xianle, LIU Lishuo, ZHANG Fengxiang, CAI Honggui. Effects of deltamethrin exposure on oxidative stress indexes and histological structure of hepatopancreas in Eriocheir sinensis [J]. , 2017, 29(8): 1261-1270.
[10]	ZHOU Xiumin, YANG Yongjiang, BI Yingjie, REN Weihe, ZHANG Li. Genetic diversity and phylogenetic relationship among domestic and foreign pig breeds based on mtDNA COXⅠ gene [J]. , 2017, 29(8): 1271-1280.
[11]	LI Jie, BAI Lipeng, CHEN Xi, YANG Fang, SHEN Liuhong, CAO Suizhong, ZUO Zhicai, REN Zhihua, MA Xiaoping, YU Shumin. Isolation, cultivation and identification of canine bone marrow mesenchymal stem cells (BMSCs) in vitro [J]. , 2017, 29(5): 751-759.
[12]	WEI Bin, TIAN Yi’nan, LI Ping, SHI Mei, CAO Xuefeng, XIAO Qicheng, TU Rui, DAN Jiaming, YANG Tingyu, PENG Guangneng, ZHONG Zhijun. Establishment of TaqMan fluorescent quantitative RT-PCR assay for detection of Canine distemper virus without nucleic acid extraction [J]. , 2017, 29(11): 1819-1826.
[13]	LUO Houqiang1， SONG Xianzhang1，*， WANG Qingyan1， DUAN Longchuan1， TU Yiqiang1， FU Hua2. Epidemiological investigation of canine parvovirus disease in small animal hospital in Wenzhou area [J]. , 2014, 26(4): 887-.
[14]	YU Hui. Diagnostic values of normal X-ray technology on different foreign bodies in canine stomach [J]. , 2013, 25(4): 0-742.
[15]	TU Jian-feng;SI Fang-fang;XING Xiu-mei;XU Jia-ping;YANG Fu-he*. Complete sequence determination and analysis of mitochondrial genome of Shaoxing duck [J]. , 2011, 23(2): 0-272.