Identification of the interaction between ZmNLP5 and promoters of ZmSTP1, ZmAAP2 gene in maize

doi:10.3969/j.issn.1004-1524.2022.11.03

Acta Agriculturae Zhejiangensis ›› 2022, Vol. 34 ›› Issue (11): 2340-2347.DOI: 10.3969/j.issn.1004-1524.2022.11.03

• Crop Science • Previous Articles Next Articles

Identification of the interaction between ZmNLP5 and promoters of ZmSTP1, ZmAAP2 gene in maize

YUAN Chongyuan(), ZHU Yuanfei, CHEN Xia, ZHU Chan, WANG Yi, TAO Haiyan, YU Jiaojiao()

School of Chemical Biology and Environment, Yuxi Normal Universtiy, Yuxi 653100, Yunnan,China

Received:2022-05-06 Online:2022-11-25 Published:2022-11-29
Contact: YU Jiaojiao

Abstract

Abstract:

Nitrogen (N) is the major limitation factor for its grain production, and both genes contain a NRE cis element in the promoter region.N use efficiency of maize may be improved by increasing the availability of carbon (C). Transporters of ZmSTP1 and ZmAPP2 play important roles in the transport and unloading of C-N assimilates in maize. In addition, both ZmSTP1 and ZmAAP2 contain NRE cis elements in promoter regions. NIN-like protein (NLP) is a conserved plant-specific transcription factor family and has been shown in several plant species to be a key player in regulating nitrogen response. ZmNLP5 is a central hub in a molecular network for mediating N signalling and metabolism. To understand whether ZmNLP5 is involved in regulating of ZmSTP1 and ZmAAP2, we used maize B73 as experimental material to explore the interaction between ZmNLP5, ZmSTP1 and ZmAAP2 by yeast one-hybrid system. The results showed that the pGADT7-ZmNLP5-1/2 were transformed into the Y1H(pAbAi-ZmSTP1) and Y1H(pAbAi-ZmAAP2) strains, respectively, they all grew normally on control medium (SD/-Leu). On selection medium (SD/-Leu/+200 ng·mL^-1AbA), the growth of Y1H(pAbAi-ZmAAP2/pGADT7-ZmNLP5-1) strain had been in normal. This result suggested that ZmNLP5 can interact with ZmAAP2 gene, ZmNLP5 is a transcription factor that can bind to the NRE element of ZmAAP2. The results of this study not only contribute to the further understanding of the regulatory mechanism of nitrate signal transduction in maize, but also provide a theoretical basis for the future study of nitrate signal transduction in other plants.

Key words: maize, yeast one-hybrid, transport protein

CLC Number:

S513

YUAN Chongyuan, ZHU Yuanfei, CHEN Xia, ZHU Chan, WANG Yi, TAO Haiyan, YU Jiaojiao. Identification of the interaction between ZmNLP5 and promoters of ZmSTP1, ZmAAP2 gene in maize[J]. Acta Agriculturae Zhejiangensis, 2022, 34(11): 2340-2347.

Figures/Tables 5

Fig.1 Schematic diagram of nitrate response element of ZmSTP1 and ZmAAP2

Table 1 The primer sequences for clone

基因 Gene	上游引物序列 Forward primer sequences(5'→3')	下游引物序列 Reverse primer sequences(5'→3')
ZmSTP1	CTGTAGAGCGTAAAACTAATATATCA	AAAATGACTAGCATTTTGGGATGG
ZmAAP2	TTGTTTGATCTTGATTGATGAAGTAATAA	ATAGAAAATAGCATAAGATATTCCAAGTAC
ZmNLP5-1	CTGAACGGTCATGGAGGAGAC	CTTGGCGAGCTTGCGGAAC
ZmNLP5-2	AGAGTGGCCTCCTCCCAAG	CTCCTGGAAGTCGGCGTC

Fig.2 Agarose gel electrophoresis image of the linearized products of bait M, 10 000 plus DNA marker;1, pAbAi-ZmAAP2 plasmid without enzyme digestion; 2, pAbAi-ZmAAP2 plasmid after single enzyme digestion; 3, pAbAi-ZmSTP1 plasmid without enzyme digestion; 4, pAbAi-ZmSTP1 plasmid after single enzyme digestion.

Fig.3 Detection of AbAr expression level in bait yeast strain A, Bait strain of Y1H(pAbAi-ZmSTP1); B, Bait strain of Y1H(pAbAi-ZmAAP2).

Fig.4 Interaction between bait DNA and prey protein was detected by yeast one-hybrid system A, Negative control of Y1H(AbAi-P53/pGADT7); B, Positive control of Y1H(AbAi-P53/pGADT7-P53); C, The interaction of pGADT7-ZmNLP5-1and Y1H(pAbAi-ZmSTP1); D, The interaction of pGADT7-ZmNLP5-2 and Y1H(pAbAi-ZmSTP1); E, The interaction of pGADT7-ZmNLP5-1 and Y1H(pAbAi-ZmAAP2); F, The interaction of pGADT7-ZmNLP5-2 and Y1H(pAbAi-ZmAAP2).

References 45

[1]	ZHANG L, TAN Q, LEE R, et al. Altered xylem-phloem transfer of amino acids affects metabolism and leads to increased seed yield and oil content in Arabidopsis[J]. The Plant Cell, 2010, 22(11): 3603-3620. DOI URL
[2]	PERCHLIK M, TEGEDER M. Leaf amino acid supply affects photosynthetic and plant nitrogen use efficiency under nitrogen stress[J]. Plant Physiology, 2018, 178(1): 174-188. DOI PMID
[3]	TEGEDER M, RENTSCH D, PATRICK J W. Organic carbon and nitrogen transporters[M]// The plant plasma membrane. Berlin, Heidelberg: Springer Berlin Heidelberg, 2010: 331-352.
[4]	BÜTTNER M. The monosaccharide transporter (-like) gene family in Arabidopsis[J]. FEBS Letters, 2007, 581(12): 2318-2324. DOI URL
[5]	BOORER K J, LOO D D, WRIGHT E M. Steady-state and presteady-state kinetics of the H⁺/hexose cotransporter (STP1) from Arabidopsis thaliana expressed in Xenopus oocytes[J]. Journal of Biological Chemistry, 1994, 269(32): 20417-20424. DOI URL
[6]	SHERSON S M, HEMMANN G, WALLACE G, et al. Monosaccharide/proton symporter AtSTP1 plays a major role in uptake and response of Arabidopsis seeds and seedlings to sugars[J]. The Plant Journal, 2000, 24(6): 849-857.
[7]	BÜTTNER M. The Arabidopsis sugar transporter (AtSTP) family: an update[J]. Plant Biology (Stuttgart, Germany), 2010, 12(Suppl 1): 35-41.
[8]	STADLER R, BÜTTNER M, ACHE P, et al. Diurnal and light-regulated expression of AtSTP1 in guard cells of Arabidopsis[J]. Plant Physiology, 2003, 133(2): 528-537. DOI URL
[9]	SLEWINSKI T L. Diverse functional roles of monosaccharide transporters and their homologs in vascular plants: a physiological perspective[J]. Molecular Plant, 2011, 4(4): 641-662. DOI PMID
[10]	SHERSON S M, ALFORD H L, FORBES S M, et al. Roles of cell-wall invertases and monosaccharide transporters in the growth and development of Arabidopsis[J]. Journal of Experimental Botany, 2003, 54(382): 525-531. DOI URL
[11]	SCHOFIELD R A, BI Y M, KANT S, et al. Over-expression of STP13, a hexose transporter, improves plant growth and nitrogen use in Arabidopsis thaliana seedlings[J]. Plant, Cell & Environment, 2009, 32(3): 271-285.
[12]	OKUMOTO S, KOCH W, TEGEDER M, et al. Root phloem-specific expression of the plasma membrane amino acid proton co-transporter AAP3[J]. Journal of Experimental Botany, 2004, 55(406): 2155-2168. PMID
[13]	FISCHER W N, ANDRÉ B, RENTSCH D, et al. Amino acid transport in plants[J]. Trends in Plant Science, 1998, 3(5): 188-195. DOI URL
[14]	FISCHER W N, KWART M, HUMMEL S, et al. Substrate specificity and expression profile of amino acid transporters (AAPs) in Arabidopsis[J]. Journal of Biological Chemistry, 1995, 270(27): 16315-16320. DOI URL
[15]	FORSUM O, SVENNERSTAM H, GANETEG U, et al. Capacities and constraints of amino acid utilization in Arabidopsis[J]. The New Phytologist, 2008, 179(4): 1058-1069. DOI URL
[16]	HIRNER B, FISCHER W N, RENTSCH D, et al. Developmental control of H⁺/amino acid permease gene expression during seed development of Arabidopsis[J]. The Plant Journal, 1998, 14(5): 535-544. DOI URL
[17]	ORTIZ-LOPEZ A, CHANG H C, BUSH D R. Amino acid transporters in plants[J]. Biochimica et Biophysica Acta (BBA)-Biomembranes, 2000, 1465(1/2): 275-280.
[18]	WAN Y F, KING R, MITCHELL R A C, et al. Spatiotemporal expression patterns of wheat amino acid transporters reveal their putative roles in nitrogen transport and responses to abiotic stress[J]. Scientific Reports, 2017, 7: 5461. DOI PMID
[19]	KONISHI M, YANAGISAWA S. Arabidopsis NIN-like transcription factors have a central role in nitrate signalling[J]. Nature Communications, 2013, 4: 1617. DOI URL
[20]	KONISHI M, YANAGISAWA S. Identification of a nitrate-responsive Cis-element in the Arabidopsis NIR1 promoter defines the presence of multiple cis-regulatory elements for nitrogen response[J]. The Plant Journal, 2010, 63(2): 269-282. DOI URL
[21]	GE M, LIU Y H, JIANG L, et al. Genome-wide analysis of maize NLP transcription factor family revealed the roles in nitrogen response[J]. Plant Growth Regulation, 2018, 84(1): 95-105. DOI URL
[22]	GE M, WANG Y, LIU Y, et al. The NIN-like protein 5 (ZmNLP5) transcription factor is involved in modulating the nitrogen response in maize[J]. The Plant Journal, 2020, 102(2): 353-368. DOI PMID
[23]	SUMIMOTO H, KAMAKURA S, ITO T. Structure and function of the PB₁ domain, a protein interaction module conserved in animals, fungi, amoebas, and plants[J]. Science's STKE, 2007, 2007(401): re6.
[24]	CHARDIN C, GIRIN T, ROUDIER F, et al. The plant RWP-RK transcription factors: key regulators of nitrogen responses and of gametophyte development[J]. Journal of Experimental Botany, 2014, 65(19): 5577-5587. DOI PMID
[25]	CASTAINGS L, CAMARGO A, POCHOLLE D, et al. The nodule inception-like protein 7 modulates nitrate sensing and metabolism in Arabidopsis[J]. The Plant Journal, 2009, 57(3): 426-435. DOI URL
[26]	KONISHI M, YANAGISAWA S. The regulatory region controlling the nitrate-responsive expression of a nitrate reductase gene, NIA1, in Arabidopsis[J]. Plant and Cell Physiology, 2011, 52(5): 824-836. DOI URL
[27]	YAN D W, EASWARAN V, CHAU V, et al. NIN-like protein 8 is a master regulator of nitrate-promoted seed germination in Arabidopsis[J]. Nature Communications, 2016, 7: 13179. DOI URL
[28]	MARCHIVE C, ROUDIER F, CASTAINGS L, et al. Nuclear retention of the transcription factor NLP7 orchestrates the early response to nitrate in plants[J]. Nature Communications, 2013, 4: 1713. DOI PMID
[29]	JIAN W, ZHANG D W, ZHU F, et al. Nitrate reductase-dependent nitric oxide production is required for regulation alternative oxidase pathway involved in the resistance to Cucumber mosaic virus infection in Arabidopsis[J]. Plant Growth Regulation, 2015, 77(1): 99-107. DOI URL
[30]	ALVAREZ J M, SCHINKE A L, BROOKS M D, et al. Transient genome-wide interactions of the master transcription factor NLP7 initiate a rapid nitrogen-response cascade[J]. Nature Communications, 2020, 11: 1157. DOI PMID
[31]	GUAN P, RIPOLL J J, WANG R, et al. Interacting TCP and NLP transcription factors control plant responses to nitrate availability[J]. Proceedings of the National Academy of Sciences of the United States of America, 2017, 114(9): 2419-2424. DOI PMID
[32]	LIU K H, NIU Y J, KONISHI M, et al. Discovery of nitrate-CPK-NLP signalling in central nutrient-growth networks[J]. Nature, 2017, 545(7654): 311-316. DOI URL
[33]	BI Y M, MEYER A, DOWNS G S, et al. High throughput RNA sequencing of a hybrid maize and its parents shows different mechanisms responsive to nitrogen limitation[J]. BMC Genomics, 2014, 15: 77. DOI URL
[34]	ZHANG H, FORDE B G. An Arabidopsis MADS box gene that controls nutrient-induced changes in root architecture[J]. Microbiology Spectrum, 1998, 279(5349): 407-409.
[35]	GOJON A, NACRY P, DAVIDIAN J C. Root uptake regulation: a central process for NPS homeostasis in plants[J]. Current Opinion in Plant Biology, 2009, 12(3): 328-338. DOI PMID
[36]	CRAWFORD N M. Nitrate: nutrient and signal for plant growth[J]. The Plant Cell, 1995, 7(7): 859-868.
[37]	PRICE J, LAXMI A, ST MARTIN S K, et al. Global transcription profiling reveals multiple sugar signal transduction mechanisms in Arabidopsis[J]. The Plant Cell, 2004, 16(8): 2128-2150. DOI URL
[38]	GÁLVEZ J H, TAI H H, LAGÜE M, et al. The nitrogen responsive transcriptome in potato (Solanum tuberosum L.) reveals significant gene regulatory motifs[J]. Scientific Reports, 2016, 6: 26090. DOI URL
[39]	LUO Z P, LIN J S, ZHU Y L, et al. NLP1 reciprocally regulates nitrate inhibition of nodulation through SUNN-CRA2 signaling in Medicago truncatula[J]. Plant Communications, 2021, 2(3): 100183. DOI URL
[40]	GAO Y Y, QUAN S X, LYU B, et al. Barley transcription factor HvNLP2 mediates nitrate signaling and affects nitrogen use efficiency[J]. Journal of Experimental Botany, 2021, 73(3): 770-783. DOI PMID
[41]	ZHAO L, LIU F, CRAWFORD N M, et al. Molecular regulation of nitrate responses in plants[J]. International Journal of Molecular Sciences, 2018, 19(7): E2039.
[42]	LIU F, XU Y, CHANG K, et al. The long noncoding RNA T5120 regulates nitrate response and assimilation in Arabidopsis[J]. The New Phytologist, 2019, 224(1): 117-131. DOI URL
[43]	ZHANG T T, KANG H, FU L L, et al. Nin-like protein 7 promotes nitrate-mediated lateral root development by activating transcription of tryptophan aminotransferase related 2[J]. Plant Science, 2021, 303: 110771. DOI URL
[44]	MENG X, YU X, WU Y, et al. Chromatin remodeling protein ZmCHB101 regulates nitrate-responsive gene expression in maize[J]. Frontiers in Plant Science, 2020, 11: 52. DOI PMID
[45]	CAO H, QI S, SUN M, et al. Overexpression of the maize ZmNLP6 and ZmNLP8 can complement the Arabidopsis nitrate regulatory mutant nlp7 by restoring nitrate signaling and assimilation[J]. Frontiers in Plant Science, 2017, 8: 1703. DOI URL

Identification of the interaction between ZmNLP5 and promoters of ZmSTP1, ZmAAP2 gene in maize

RichHTML

PDF (PC)

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 5

References 45

Related Articles 15

Recommended Articles

Metrics

Comments

[1]	MENG Fanhao, YANG Hengshan, ZHANG Ruifu, ZHANG Yuqin, LI Weimin, ZHANG Yushan, ZHANG Mingwei. Effects of irrigation methods on yield and water and nitrogen utilization efficiency of spring maize in Xiliaohe Plain, China [J]. Acta Agriculturae Zhejiangensis, 2022, 34(9): 1826-1836.
[2]	HU Kaibo, YANG Qingxia, LI Yang, WU Kaixian, ZHAO Ping, LONG Guangqiang. Effect of application of amino acid fertilizer on spring maize cultivation under nitrogen reduction [J]. Acta Agriculturae Zhejiangensis, 2022, 34(4): 661-670.
[3]	JIA Liqiang, ZHAO Qiufang, CHEN Shu, DING Bo. Expression analysis of bZIP G subfamily genes in maize [J]. Acta Agriculturae Zhejiangensis, 2022, 34(2): 221-231.
[4]	CUI Wenfang, CHEN Jing, LU Fukuan, QIN Li, QIN Dezhi, WANG Liping, GAO Julin. Effects of biochar application combined with nitrogen reduction on yield and nitrogen use efficiency of maize [J]. Acta Agriculturae Zhejiangensis, 2022, 34(2): 248-254.
[5]	GAO Xin, YANG Hengshan, ZHANG Ruifu, ZHANG Yuqin, LI Rui, ZHANG Mingwei. Difference analysis on seed yield and root cap characteristics for spring maize under water fertilizer and high yield optimization of shallow burying drip irrigation [J]. Acta Agriculturae Zhejiangensis, 2022, 34(1): 1-9.
[6]	WANG Jia, MU Ruirui, YANG Qiaoqiao, LIU Wei, ZHANG Yuehe, KANG Jianhong. Effects of potassium application rate on chlorophyll fluorescence characteristics and yield of spring maize in Ningxia under integrated drip irrigation [J]. Acta Agriculturae Zhejiangensis, 2021, 33(8): 1347-1357.
[7]	ZHANG Yuxun, WANG Lei, QU Xiangning, CAO Yuan, WU Mengyao, YU Ruixin, SUN Yuan. Application research of GF-1/WFV data in estimation of maize leaf area index [J]. Acta Agriculturae Zhejiangensis, 2021, 33(5): 861-872.
[8]	YANG Mei, HU Xiaolan, SHEN Tao, TAN Kang, LIU Dailing, QIU Hongbo. Construction of single fragment substitution lines of maize 8th chromosome and sreening of resistant maize germplasm to gray leaf spot [J]. Acta Agriculturae Zhejiangensis, 2021, 33(3): 383-389.
[9]	QU Zhan, YANG Litao. Development of plasmid DNA reference material of genetically modified maize TC1507 [J]. Acta Agriculturae Zhejiangensis, 2021, 33(3): 390-395.
[10]	WANG Bo, ZHANG Yongqiang, GONG Siyu, DONG Quanyao, FU Xiaozhao. Impact of Internet development in rural area on total factor productivity of maize in China [J]. Acta Agriculturae Zhejiangensis, 2021, 33(12): 2435-2445.
[11]	LIU Genhong, XUE Yinxin, ZHANG Qian, ZHOU Jiarui, MAI Xiaofeng. Effects of different tillage depth and amount of straw returned to the field on maize growth under drip-irrigation [J]. Acta Agriculturae Zhejiangensis, 2021, 33(1): 8-17.
[12]	CHANG Huiqing, XU Fujin, PAN Yajie. Passivation effects of calcium carbonate with/without chitosan on chromium pollution in calcareous soil [J]. , 2020, 32(9): 1665-1671.
[13]	GUO Yanjing, XIAO Haifeng. Support level and structural characteristics of maize subsidy policy in world's major maize producing countries and region [J]. , 2020, 32(9): 1722-1731.
[14]	ZHAO Xingkai, SHI Haichun, YU Xuejie, YANG Shu, ZHAO Changyun, XIA Wei, KE Yongpei. Breeding potential analyses of 13 new inbred lines in maize [J]. Acta Agriculturae Zhejiangensis, 2020, 32(12): 2119-2127.
[15]	JIANG Yuanyuan, JI Yi, LAI Yongmin, CHEN Xiaoyun, XU Junfeng, XU Xiaoli, MA Lianju. Safety evaluation of Cry-transgenic insect-resistant maize on silkworm, Bombyx mori [J]. , 2020, 32(11): 2042-2049.