Identification of host RNA-binding proteins interacting with infectious bronchitis virus N protein

doi:10.3969/j.issn.1004-1524.20250304

Acta Agriculturae Zhejiangensis ›› 2026, Vol. 38 ›› Issue (4): 632-642.DOI: 10.3969/j.issn.1004-1524.20250304

• Animal Science • Previous Articles Next Articles

Identification of host RNA-binding proteins interacting with infectious bronchitis virus N protein

DAI Xueyan(), XIAO Peng, FU Xuezhen, HU Jie, CHANG Yuxin, ZHAO Wei, LIAO Min()

Key Laboratory of Animal Virology of Ministry of Agriculture and Rural Affairs, College of Animal Sciences, Zhejiang University, Hangzhou 310058, China

Received:2025-04-15 Online:2026-04-25 Published:2026-05-08
Contact: LIAO Min

Abstract

Abstract:

To screen host RNA-binding proteins interacting with the infectious bronchitis virus (IBV) N protein, providing a basis for elucidating the virus-host interaction mechanism, co-immunoprecipitation (Co-IP) combined with mass spectrometry was employed to identify host proteins interacting with the N protein with the monoclonal antibody 4H4 against IBV N protein. Differentially expressed proteins were subjected to bioinformatics analysis, and Co-IP experiments were conducted to validate the interactions between the N protein and candidate RNA-binding proteins. The results showed that a total of 847 differentially expressed proteins were identified, primarily involved in processes such as transcription, translation and protein modification, protein-RNA complex assembly, signal transduction, and energy metabolism. Co-IP experimental results indicated that interactions exist between the N protein and the host RNA-binding proteins TARDBP, hnRNPK, FUBP3, and hnRNPA1. This study identified host proteins interacting with the IBV N protein, which are involved in multiple key stages of the viral replication cycle. The interactions between the N protein and RNA-binding proteins provide new research directions for elucidating the specific mechanisms of host proteins in viral infection.

Key words: infectious bronchitis virus, N protein, RNA-binding protein, virus-host interaction, co-immunoprecipitation, monoclonal antibody

CLC Number:

S855.3

DAI Xueyan, XIAO Peng, FU Xuezhen, HU Jie, CHANG Yuxin, ZHAO Wei, LIAO Min. Identification of host RNA-binding proteins interacting with infectious bronchitis virus N protein[J]. Acta Agriculturae Zhejiangensis, 2026, 38(4): 632-642.

Figures/Tables 10

Table 1 Primer information for eukaryotic expression plasmids

基因名称 Gene name	正向引物序列(5'→3') Forward primer sequence (5'→3')	反向引物序列(5'→3') Reverse primer sequence (5'→3')
TARDBP	GCCCGAATTCGGTCGAATGTCGGAGTACATCCGGGT	GGATCCCCGCGGCCGCGCTACATTCCCCAGCCTGACG
hnRNPK	GCCCGAATTCGGTCGACCATGGAGACTGAACAACAGGAGGA	GGATCCCCGCGGCCGCGTTAGAATCCTTCAACATCTGCATACT
hnRNPA1	GCCCGAATTCGGTCGACCATGGCCAAGTCGGAGTCTCCAAAGGA	GGATCCCCGCGGCCGCGTCAGAACCTCCTCCCTCCGCCGTA
FUBP3	GCCCGAATTCGGTCGAATGGCGGAGCTGGCGCA	GGATCCCCGCGGCCGCGCTACTGCTCCTGGCTGTGGGC

Fig.1 Identification of concentrated IBV YC181031 antigen A, RT-PCR identification results of concentrated IBV samples; B, Western blot detection results of IBV. M, Protein marker; 1, Sample before concentration; 2, Sample after concentration; 3, Supernatant sample.

Fig.2 Reactivity of the N protein monoclonal antibodies A, Identification by ELISA; B, Identification by Western blot; C, Identification by IFA. M, Protein marker; 1, Concentrated solution of YC181031 virus; 2, Purified prokaryotically expressed N protein.

Fig.3 Changes of N protein expression levels after IBV infection

Fig.4 Identification of IBV-interacting proteins in infected cells A, Western blot detection of the binding between the N protein and protein A/G magnetic beads; B, Silver staining identification of differential bands (red arrows indicate differential proteins); M, Protein marker.

Fig.5 GO functional analysis of host cell proteins interacting with the N protein BP, Biological process; CC, Cellular component; MF, Molecular function.

Fig.6 COG functional classification of host cell proteins interacting with the N protein

Fig.7 KEGG metabolic pathway annotation of host cell proteins interacting with N protein

Fig.8 Interaction map of host cell proteins interacting with N protein

Fig.9 Co-IP validation of the interaction between IBV N protein and host cell RBP A, PCR amplification of target fragments; M, DNA marker; 1, TARDBP; 2, hnRNPK; 3, FUBP3; 4. hnRNPA1. B. Co-immunoprecipitation for protein interaction identification.

References 29

[1]	ZHAO J, ZHAO Y, ZHANG G Z. Key aspects of coronavirus avian infectious bronchitis virus[J]. Pathogens, 2023, 12(5): 698.
[2]	FALCHIERI M, COWARD V J, REID S M, et al. Infectious bronchitis virus: an overview of the “chicken coronavirus”: this article is part of the JMM Profiles collection[J]. Journal of Medical Microbiology, 2024, 73(5): 001828.
[3]	KOTTIER S A, CAVANAGH D, BRITTON P. Experimental evidence of recombination in coronavirus infectious bronchitis virus[J]. Virology, 1995, 213(2): 569-580.
[4]	SHI Q, WANG C, KEIRS R W. Genetic relationships of infectious bronchitis virus isolates from Mississippi broilers[J]. Avian Diseases, 2000, 44(1): 66-73.
[5]	LOPES P D, OKINO C H, SANTOS FERNANDO F, et al. Inactivated infectious bronchitis virus vaccine encapsulated in chitosan nanoparticles induces mucosal immune responses and effective protection against challenge[J]. Vaccine, 2018, 36(19): 2630-2636.
[6]	QUINTEROS J, NOORMOHAMMADI A, LEE S, et al. Genomics and pathogenesis of the avian coronavirus infectious bronchitis virus[J]. Australian Veterinary Journal, 2022, 100(10): 496-512.
[7]	DAVIES H A, DOURMASHKIN R R, MACNAUGHTON M R. Ribonucleoprotein of avian infectious bronchitis virus[J]. Journal of General Virology, 1981, 53(1): 67-74.
[8]	MAGHSOOD F, GHORBANI A, YADEGARI H, et al. SARS-CoV-2 nucleocapsid: biological functions and implication for disease diagnosis and vaccine design[J]. Reviews in Medical Virology, 2023, 33(3): e2431.
[9]	FAN H, OOI A, TAN Y W, et al. The nucleocapsid protein of coronavirus infectious bronchitis virus: crystal structure of its N-terminal domain and multimerization properties[J]. Structure, 2005, 13(12): 1859-1868.
[10]	SINGH G, PRATT G, YEO G W, et al. The clothes make the mRNA: past and present trends in mRNP fashion[J]. Annual Review of Biochemistry, 2015, 84: 325-354.
[11]	GERSTBERGER S, HAFNER M, TUSCHL T. A census of human RNA-binding proteins[J]. Nature Reviews Genetics, 2014, 15(12): 829-845.
[12]	WANG K, HUANG M Z, ZENG Q H, et al. Characterization and functional analysis of chicken hnRNP protein[J]. Poultry Science, 2025, 104(3): 104859.
[13]	HU X F, WU X D, DING Z, et al. Characterization and functional analysis of chicken dsRNA binding protein hnRNPU[J]. Developmental & Comparative Immunology, 2023, 138: 104521.
[14]	WANG Q, ZHANG Q, ZHENG M Q, et al. Viral-host interactome analysis reveals chicken STAU2 interacts with non-structural protein 1 and promotes the replication of H5N1 avian influenza virus[J]. Frontiers in Immunology, 2021, 12: 590679.
[15]	YE H L, BI Z W, FAN W T, et al. Cellular hnRNPAB interacts with avian influenza viral protein PB2 and inhibits virus replication potentially by restricting PB2 mRNA nuclear export and PB2 protein level[J]. Virus Research, 2021, 305: 198573.
[16]	LUO L L, LI Z A, ZHAO T J, et al. SARS-CoV-2 nucleocapsid protein phase separates with G3BPs to disassemble stress granules and facilitate viral production[J]. Science Bulletin, 2021, 66(12): 1194-1204.
[17]	WU Y X, MA L, CAI S H, et al. RNA-induced liquid phase separation of SARS-CoV-2 nucleocapsid protein facilitates NF-κB hyper-activation and inflammation[J]. Signal Transduction and Targeted Therapy, 2021, 6: 167.
[18]	肖鹏. 传染性支气管炎病毒优势疫苗株的筛选与初步评价[D]. 杭州: 浙江大学, 2021.
	XIAO P. Screening and preliminary evaluation of dominant vaccine strains of infectious bronchitis virus[D]. Hangzhou: Zhejiang University, 2021.
[19]	HAN Y W, ZHOU H W, LIU C, et al. SARS-CoV-2 N protein coordinates viral particle assembly through multiple domains[J]. Journal of Virology, 2024, 98(11): e01036-e01024.
[20]	CHEN H, CUI Y, HAN X L, et al. Liquid-liquid phase separation by SARS-CoV-2 nucleocapsid protein and RNA[J]. Cell Research, 2020, 30(12): 1143-1145.
[21]	XUE W X, CHU H Y, WANG J H, et al. Coronavirus nucleocapsid protein enhances the binding of p-PKCα to RACK1: implications for inhibition of nucleocytoplasmic trafficking and suppression of the innate immune response[J]. PLoS Pathogens, 2024, 20(11): e1012097.
[22]	XU Z K, ANDERSON R, HOBMAN T C. The capsid-binding nucleolar helicase DDX56 is important for infectivity of west Nile virus[J]. Journal of Virology, 2011, 85(11): 5571-5580.
[23]	ZHANG T, ZHENG H L, LU D J, et al. RNA binding protein TIAR modulates HBV replication by tipping the balance of pgRNA translation[J]. Signal Transduction and Targeted Therapy, 2023, 8: 346.
[24]	LUO H B, CHEN Q, CHEN J, et al. The nucleocapsid protein of SARS coronavirus has a high binding affinity to the human cellular heterogeneous nuclear ribonucleoprotein A1[J]. FEBS Letters, 2005, 579(12): 2623-2628.
[25]	WANG Y C, ZHANG X M. The nucleocapsid protein of coronavirus mouse hepatitis virus interacts with the cellular heterogeneous nuclear ribonucleoprotein A1 in vitro and in vivo[J]. Virology, 1999, 265(1): 96-109.
[26]	SHI S T, HUANG P Y, LI H, et al. Heterogeneous nuclear ribonucleoprotein A1 regulates RNA synthesis of a cytoplasmic virus[J]. The EMBO Journal, 2000, 19(17): 4701-4711.
[27]	WEI W Q, BAI L, YAN B, et al. When liquid-liquid phase separation meets viral infections[J]. Frontiers in Immunology, 2022, 13: 985622.
[28]	ZHANG X Y, ZHENG R, LI Z S, et al. Liquid-liquid phase separation in viral function[J]. Journal of Molecular Biology, 2023, 435(16): 167955.
[29]	PERDIKARI T M, MURTHY A C, RYAN V H, et al. SARS-CoV-2 nucleocapsid protein phase-separates with RNA and with human hnRNPs[J]. The EMBO Journal, 2020, 39(24): EMBJ2020106478.

Identification of host RNA-binding proteins interacting with infectious bronchitis virus N protein

RichHTML

PDF (PC)

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 10

References 29

Related Articles 15

Recommended Articles

Metrics

Comments

[1]	LI Huaxin, YANG Xuankang, CHEN Ying, WU Xiaoting, LIU Silian, YANG Zhong, ZHOU Chenggang, GAO Dandan. Optimization of the preparation process and separation purification of antioxidant peptides from oat bran protein [J]. Acta Agriculturae Zhejiangensis, 2025, 37(9): 1958-1968.
[2]	LI Ju, BI Donglin, YANG Xiaoli, YANG Dongliang, ZHANG Xiaowen, LIU Fangcheng, LI Qiongyi, BAI Jialin. Preparation and identification of monoclonal antibodies against non-structural protein C of Peste des petits ruminants virus [J]. Acta Agriculturae Zhejiangensis, 2024, 36(5): 1047-1054.
[3]	LIU Zhiyi, MI Xiaoyun, HUANG Cong, LI Chuanfeng, CHEN Zongyan. Effect of interaction between translocation-associated membrane protein 1 and σNS protein on replication of duck reovirus [J]. Acta Agriculturae Zhejiangensis, 2022, 34(7): 1396-1401.
[4]	HONG Senrong, XIANG Qiongyu, XIE Ying, XIONG Chenlu, XU Chenhui, XU Luke, CHEN Ronghua, CAI Hong. Gene cloning, subcellular localization and tissue expression analysis of tobamovirus multiplication protein 1 gene of Tetrastigma hemsleyanum Diels et Gilg in Huaiyushan [J]. Acta Agriculturae Zhejiangensis, 2022, 34(6): 1193-1204.
[5]	SHEN Weifeng, GUO Qi, LIU Li, NIU Baolong, WENG Hongbiao, LOU Bao. Cloning, expression and application in detection of SWP2 gene in Enterocytozoon hepatopenaei [J]. Acta Agriculturae Zhejiangensis, 2021, 33(6): 993-1000.
[6]	YANG Ju, DENG Junliang, XIA Jiangying, SONG Tianhao, PANG Lianfeng, REN Zhihua. Effect of vitamin A on barrier function damage of piglet intestinal epithelial cells induced by soybean 7S globulin [J]. Acta Agriculturae Zhejiangensis, 2021, 33(11): 2026-2033.
[7]	GUO Fucheng, JIN Li, SU Qiang, SU Yuxin, LI Fanglin, CHEN Shien, MA Xiaoxia. Prokaryotic expression and purification of PEDV N protein and analysis of B cell antigen epitope [J]. , 2020, 32(5): 762-769.
[8]	WANG Xichun, CAO Li, LIU Qin, DONG Yanli, WANG Zhongzheng, LIU Jinfang, ZHU Lei, FENG Shibin, LI Yu, WU Jinjie. Effects of single and combined exposure of deoxynivalenol and aflatoxin B₁ on pathological changes, antioxidant capacity and tight junction protein expression of brain tissue in mice [J]. , 2019, 31(6): 886-892.
[9]	ZONG Qiufang, QIN Weiyun, HUO Yongjiu, WU Shenglong, BAO Wenbin. Research progress of intestinal epithelial tight junction proteins in piglets [J]. , 2018, 30(8): 1435-1444.
[10]	ZONG Qiufang, HUANG Yanjie, WU Lisi, WU Shenglong, BAO Wenbin. Analysis of genetic codon usage preference in pig Claudin family [J]. , 2018, 30(12): 2007-2017.
[11]	LI Haolei, LI Yezhen, ZHAO Gu, CUI Tengfei, XU Qianming, WEI Jianzhong, LI Yu, SUN Pei. Recombinant eukaryotic plasmid construction of porcine epidemic diarrhea virus of N gene and its expression [J]. , 2017, 29(7): 1103-1109.
[12]	ZHANG Lin, YU Bin, NI Zheng, CHEN Liu, YUN Tao, YE Weicheng, HUA Jionggang, CUI Yanshun, ZHANG Cun. Identification of linear B cell epitope for E protein of duck Tembusu virus [J]. , 2017, 29(12): 2009-2014.
[13]	YAN Huili， XI Jun*， GAO Xuemei， HE Mengxue， CHEN Zhe， LU Qiyu. Preparation of monoclonal antibodies against Gly m Bd 28K and identification of their immunological properties [J]. , 2016, 28(5): 748-.
[14]	ZHANG Jun, ZHU Jian-jin, LIU Jiang-ying, JIANG Rong, CHENG Xiang-rong. Effects of fermentation metabolite produced by probiotics on intestinal morphology and intestinal barrier function in chicken [J]. , 2016, 28(10): 1657-1662.
[15]	LIU Su\\|jun， DUAN Song\\|huan， HU Jing\\|yan， JIN Jun\\|jie， TU Yi\\|qiang， BAI Yu*. Preparation and identification of monoclonal antibodies against the nucleocapsid protein of porcine epidemic diarrhea virus [J]. , 2015, 27(6): 950-.