Functional study of a β-glucosidase Foglu1 in Fusarium oxysporum f. sp. conglutinans

doi:10.3969/j.issn.1004-1524.2023.02.15

Acta Agriculturae Zhejiangensis ›› 2023, Vol. 35 ›› Issue (2): 373-382.DOI: 10.3969/j.issn.1004-1524.2023.02.15

• Plant Protection • Previous Articles Next Articles

Functional study of a β-glucosidase Foglu1 in Fusarium oxysporum f. sp. conglutinans

WANG Teng(), WANG Bixiang, LI Shiyao, WEI Jing, LI Erfeng()

College of Horticulture and Landscape Architecture, Tianjin Agricultural University, Tianjin 300392, China

Received:2022-04-08 Online:2023-02-25 Published:2023-03-14
Contact: LI Erfeng

Abstract

Abstract:

Fusarium oxysporum f. sp. conglutinans(FOC) is a causal agent of cabbage Fusarium wilt. The β-glucosidase is a rate-limiting enzyme for cellulose degradation. In this study, to determine biological roles of a β-glucosidase (Foglu1) in fungal development and virulence of FOC, the Foglu1 gene was knocked out by split-marker homologous recombination and complementation strains were generated by reintroducing Foglu1 gene into ΔFoglu1 mutant. Then, phenotypes of the wild type strain, deletion mutant ΔFoglu1 and complemented strain ΔFoglu1-C were analyzed. The result showed that the colony diameter of ΔFoglu1 mutant was significantly reduced by 19.6% compared to that of the wild type in cell membrane stress experiment (0.05% SDS), indicating that Foglu1 was required for cell integrity in FOC. Also, in oxygen stress experiment (0.1% H₂O₂), colony diameter of ΔFoglu1 mutant significantly decreased by 14% compared with the wild type, indicating that deletion of Foglu1 resulted in the increase of sensitivity to oxygen stress. Meanwhile, conidial production of ΔFoglu1 mutant was reduced by 22.3% compared to the wild type, indicating that Foglu1 gene was important for sporulation in FOC. Interestingly, at 8 days after inoculation, disease index of ΔFoglu1 mutant was significantly reduced and 39.5% lower than that of the wild type. The disease indexes of seedlings inoculated with the wild type, ΔFoglu1 and ΔFoglu1-C were no differences at 11, 15 and 18 days after inoculation. It showed that Foglu1 played roles in the early interaction between the pathogen and the host. It could delay the disease development but had no effect on pathogenicity. In conclusion, these findings suggested that β-glucosidase (Foglu1) played an important role in FOC cell membrane integrity, oxidative stress, sporulation and pathogenesis.

Key words: cabbage Fusarium wilt, gene knockout, β-glucosidase, pathogenicity

CLC Number:

S432.1

WANG Teng, WANG Bixiang, LI Shiyao, WEI Jing, LI Erfeng. Functional study of a β-glucosidase Foglu1 in Fusarium oxysporum f. sp. conglutinans[J]. Acta Agriculturae Zhejiangensis, 2023, 35(2): 373-382.

Figures/Tables 8

Table 1 Names and sequences of primers

引物名称 Primer name	引物序列 Primer sequence (5'→3')
UP-F	GCCACCTGCTTCACTTCTGC
UP-R	CATTGTTGACCTCCACTAGCTCCAGCCAAGGGAGGGGAGAGAAGCCTCAG
DOWN-F	GGCAAAGGAATAGAGTAGATGCCGACCGGGCAGCTGTATGTCAGCCTCGG
DOWN-R	GACATCCAAGGAACAGCGCC
Foglu1-CHECK-F	GCCAGAACTCCAAGCTCCTC
Foglu1-CHECK-R	GCTCATCTCCCTGTTGCCAG
H-F	GGACTAGTCCCGAGCAAGGACTCATGCGTG
H-R	AACTGCAGAACCAATGCATTGGCCACGACACTGTTCCTTCCG
NEO-CHECK-F	CCAGGGTTTTCCCAGTCACG
NEO-CHECK-R	GATCGACAAGACCGGCTTCC
HPT-F	CTTGGCTGGAGCTAGTGGAGGT
HPT-R	CCCGGTCGGCATCTACTCTATTC
HPT-R1	GGATGCCTCCGCTCGAAGTA
HPT-F2	CGTTGCAAGACCTGCCTGAA
UPCHECK-F	CCTGCATCTGCATACCACCC
UPCHECK-R	GGATGCCTCCGCTCGAAGTA
DOWNCHECK-F	CGTTGCAAGACCTGCCTGAA
DOWNCHECK-R	CTGCTTCCAGCCTCATACGC
EF1α-F	CATCGGCCACGTCGACTCT
EF1α-R	AGAACCCAGGCGTACTTGAA
Foglu1-F	CCAACAACGAATGGGCCCAG
Foglu1-R	GCTCATCTCCCTGTTGCCAG
hpt-F	GTCACGTTGCAAGACCTGCC
hpt-R	CGCGCATATGAAATCACGCC

Fig.1 Structural domain and phylogenetic relationship analysis of the β-glucosidase homologs from different fungal species A, Conserved domains of β-glucosidase in F. oxysporum f. sp. conglutinans based on Pfam analysis. The red represented the glycosyl hydrolase family 3 N-terminal domain. The green represented the glycosyl hydrolase family 3 C-terminal domain. The purple represented the fibronectin type Ⅲ-like domain. B, Phylogenetic relationship of the β-glucosidase homologs from different fungal species. F. oxysporum f. sp. conglutinans was marked with blue triangle.

Fig.2 Knockout of Foglu1 gene A, Amplification of homologous replacement arms. M, Trans 2K Plus Maker; 1, Fragment of UP-HPT1; 2, Fragment of HPT2-DOWN. B, Strategy of gene knockout.

Fig.3 Verification of ΔFoglu1 mutants A, PCR verification of ΔFoglu1 mutants. M, Trans 2K Plus Maker; 1, ΔFoglu1-1 mutant; 2, ΔFoglu1-2 mutant; WT, Wild type. B, qRT-PCR verification of gene copy number in ΔFoglu1 mutants.

Fig.4 PKN-Foglu1 enzyme digestion and ΔFoglu1-C validation A, Enzymatic digestion validation of PKN-Foglu1. M, Trans 15K maker; 1, Single cleavage of PKN plasmid; 2, Single cleavage of PKN-Foglu1 plasmid; 3, Double digestion of PKN-Foglu1 plasmid; 4, Double digestion of Foglu1 complement fragment. B, Validation of complement strain ΔFoglu1-C. M, Trans 2K Plus Maker; 1, NEO-CHECK fragment of ΔFoglu1-C; 2, NEO-CHECK fragment of ΔFoglu1; 3, Foglu1-CHECK fragment of ΔFoglu1-C; 4, Foglu1-CHECK fragment of ΔFoglu1.

Fig.5 Stress measurement of ΔFoglu1 mutant growth A, Colonies under different stresses for 5 days; B, Variance analysis of colony diameter. The same letters above the column indicated that the data were not significant (P>0.05) in one-way ANOVA, different letters indicated significant (P<0.05). The same as below.

Fig.6 Conidia production of wild type and mutant stains

Fig.7 Deletion of the Foglu1 gene leads to reduced virulence in the initial stage of FOC infected cabbage A, The growth of cabbage inoculated with FOC at 8 days, 11 days and 15 days after inoculation; B, The disease indexes of wild type, ΔFoglu1 and ΔFoglu1-C from 4 to 18 days after inoculation.

References 24

[1]	杨丽梅, 方智远, 张扬勇, 等. “十三五”我国甘蓝遗传育种研究进展[J]. 中国蔬菜, 2021(1): 15-21.
	YANG L M, FANG Z Y, ZHANG Y Y, et al. Research progress on cabbage genetic breeding during The Thirteenth Five-year Plan’ in China[J]. China Vegetables, 2021(1): 15-21. (in Chinese)
[2]	吕红豪, 方智远, 杨丽梅, 等. 甘蓝枯萎病抗源材料筛选及抗性遗传研究[J]. 园艺学报, 2011, 38(5): 875-885.
	LÜ H H, FANG Z Y, YANG L M, et al. Research on screening of resistant resources to Fusarium wilt and inheritance of the resistant gene in cabbage[J]. Acta Horticulturae Sinica, 2011, 38(5): 875-885. (in Chinese with English abstract)
[3]	PAUGH K R, GORDON T R. The population of Fusarium oxysporum f. sp. lactucae in California and Arizona[J]. Plant Disease, 2020, 104(6): 1811-1816.
[4]	CHAKRABORTY N. Salicylic acid and nitric oxide cross-talks to improve innate immunity and plant vigor in tomato against Fusarium oxysporum stress[J]. Plant Cell Reports, 2021, 40(8): 1415-1427.
[5]	CHANG H X, NOEL Z A, CHILVERS M I. A β-lactamase gene of Fusarium oxysporum alters the rhizosphere microbiota of soybean[J]. The Plant Journal: for Cell and Molecular Biology, 2021, 106(6): 1588-1604.
[6]	LI C Y, ZUO C W, DENG G M, et al. Contamination of bananas with beauvericin and fusaric acid produced by Fusarium oxysporum f. sp. cubense[J]. PLoS One, 2013, 8(7): e70226.
[7]	LI B, GAO Y, MAO H Y, et al. The SNARE protein FolVam7 mediates intracellular trafficking to regulate conidiogenesis and pathogenicity in Fusarium oxysporum f. sp. lycopersici[J]. Environmental Microbiology, 2019, 21(8): 2696-2706.
[8]	GAO T, ZHENG Z T, HOU Y P, et al. Transcription factors spt3 and spt8 are associated with conidiation, mycelium growth, and pathogenicity in Fusarium graminearum[J]. FEMS Microbiology Letters, 2014, 351(1): 42-50.
[9]	ZURIEGAT Q, ZHENG Y R, LIU H, et al. Current progress on pathogenicity-related transcription factors in Fusarium oxysporum[J]. Molecular Plant Pathology, 2021, 22(7): 882-895.
[10]	SINGHANIA R R, PATEL A K, SUKUMARAN R K, et al. Role and significance of beta-glucosidases in the hydrolysis of cellulose for bioethanol production[J]. Bioresource Technology, 2013, 127: 500-507.
[11]	VOLKOV P V, ROZHKOVA A M, ZOROV I N, et al. Cloning, purification and study of recombinant GH3 family β-glucosidase from Penicillium verruculosum[J]. Biochimie, 2020, 168: 231-240.
[12]	MOHSIN I, POUDEL N, LI D C, et al. Crystal structure of a GH3 β-glucosidase from the thermophilic fungus Chaetomium thermophilum[J]. International Journal of Molecular Sciences, 2019, 20(23): 5962.
[13]	DAVIES G J, GLOSTER T M, HENRISSAT B. Recent structural insights into the expanding world of carbohydrate-active enzymes[J]. Current Opinion in Structural Biology, 2005, 15(6): 637-645.
[14]	HIMMEL M E, DING S Y, JOHNSON D K, et al. Biomass recalcitrance: engineering plants and enzymes for biofuels production[J]. Science, 2007, 315(5813): 804-807.
[15]	CALERO-NIETO F, DI PIETRO A, RONCERO M I, et al. Role of the transcriptional activator xlnR of Fusarium oxysporum in regulation of xylanase genes and virulence[J]. Molecular Plant-Microbe Interactions, 2007, 20(8): 977-985.
[16]	HUANG Y, YU C L, SUN C C, et al. β-glucosidase VmGlu2 contributes to the virulence of Valsa mali in apple tree[J]. Frontiers in Microbiology, 2021, 12: 695112.
[17]	SOLOMON P S, IPCHO S V S, HANE J K, et al. A quantitative PCR approach to determine gene copy number[J]. Fungal Genetics Reports, 2008, 55(1): 5-8.
[18]	LI E F, WANG G, YANG Y H, et al. Microscopic analysis of the compatible and incompatible interactions between Fusarium oxysporum f. sp. conglutinans and cabbage[J]. European Journal of Plant Pathology, 2015, 141(3): 597-609.
[19]	LOU H W, YE Z W, YUN F, et al. Targeted gene deletion in Cordyceps militaris using the split-marker approach[J]. Molecular Biotechnology, 2018, 60(5): 380-385.
[20]	ZHOU C S, QIAN L C, MA H L, et al. Enhancement of amygdalin activated with β-D-glucosidase on HepG2 cells proliferation and apoptosis[J]. Carbohydrate Polymers, 2012, 90(1): 516-523.
[21]	BIVER S, STROOBANTS A, PORTETELLE D, et al. Two promising alkaline β-glucosidases isolated by functional metagenomics from agricultural soil, including one showing high tolerance towards harsh detergents, oxidants and glucose[J]. Journal of Industrial Microbiology & Biotechnology, 2014, 41(3): 479-488.
[22]	ZHANG Z Q, CHEN Y, LI B Q, et al. Reactive oxygen species: a generalist in regulating development and pathogenicity of phytopathogenic fungi[J]. Computational and Structural Biotechnology Journal, 2020, 18: 3344-3349.
[23]	MONTIBUS M, PINSON-GADAIS L, RICHARD-FORGET F, et al. Coupling of transcriptional response to oxidative stress and secondary metabolism regulation in filamentous fungi[J]. Critical Reviews in Microbiology, 2015, 41(3): 295-308.
[24]	KARKEHABADI S, HANSSON H, MIKKELSEN N E, et al. Structural studies of a glycoside hydrolase family 3 β-glucosidase from the model fungus Neurospora crassa[J]. Acta Crystallographica Section F, Structural Biology Communications, 2018, 74(Pt 12): 787-796.

Functional study of a β-glucosidase Foglu1 in Fusarium oxysporum f. sp. conglutinans

RichHTML

PDF (PC)

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 8

References 24

Related Articles 15

Recommended Articles

Metrics

Comments

[1]	PU Meiying, WU Ziqiang, ZHANG Shiwen, LI Yanjie, ZHU Youjiao, WU Kun, CHEN Longqing, WANG Chao. Isolation and identification of petal blight disease of Camellia japonica [J]. Acta Agriculturae Zhejiangensis, 2023, 35(1): 121-127.
[2]	ZHAN Jiafei, XU Kui, ZHANG Lei, XIA Jieying, HONG Yang, DONG Han, LIU Yanglu, ZHOU Jing, YUAN Mingming, WANG Yongjin, YAN Liangchun. Verbascoside lowers Streptococcus suis serotype 2 pathogenicity in mice by inhibiting hemolytic activity of suilysin [J]. Acta Agriculturae Zhejiangensis, 2022, 34(8): 1609-1616.
[3]	CHEN Zhang, WU Huajian, MAO Tianjiao, HAN Yeqin, SUN Pei, WEI Jianzhong, LI Dongfeng, LI Yu. Screening of strain for inactivated vaccine of Streptococcus suis type 2 [J]. , 2020, 32(1): 57-64.
[4]	ZHANG Yan, QI Yuhua, LU Yanhua, YANG Qiankun, HE Yujuan, LI Junmin, CHEN Jianping. Identification and analysis on pathogenicity-related domain of P3 protein of wheat yellow mosaic virus [J]. , 2019, 31(5): 777-783.
[5]	CAI Yue, WANG Chuyan, HUANG Minghua, CHENG Junwen, QIAN Zhongyi, GE Chunmei. Identification of Fusarium pathogens of Albizia julibrissin wilt and their cultural characteristics [J]. , 2019, 31(4): 588-599.
[6]	WU Qiongjuan, YANG Zhipeng, YAO Yanbin, LU Ping, WEI Jianzhong, SUN Pei, LI Yu. Screening of strains for inactivated vaccine of Erysipelothrix rhusiopathiae [J]. , 2018, 30(9): 1467-1475.
[7]	WANG Xin, CHENG Liang, WANG Yayi, GAO Xusheng, LI Songling. Identification of blackleg pathogen on potato (Solanum tuberosum L.) in Qinghai [J]. , 2018, 30(8): 1369-1375.
[8]	FENG Xiaoxiao, LI Haijiao, LI Ling, WANG Jiaoyu, LIN Fucheng, LU Jianping. MoSOK1, a putative germinal center kinase encoding gene, is required for fungal growth, conidiation and pathogenicity in Magnaporthe oryzae [J]. , 2018, 30(6): 999-1007.
[9]	YUAN Xuemei, YAO Jiayun, LIN Lingyun, PAN Xiaoyi, XU Yang, YIN Wenlin, SHEN Jinyu. Isolation and identification of pathogenic Aeromonas veronii from Misgurnus anguillicaudatus [J]. , 2018, 30(5): 730-737.
[10]	ZHONG Rui, JIANG Yaozhang, MA Xiaoping, ZUO Zhicai, HUANG Xiaoli, DENG Junliang, SHEN Liuhong, YU Shumin. Isolation, identification and drug sensitive test of Trichosporon loubieri from beef cattle [J]. , 2018, 30(1): 26-35.
[11]	YAO Kechang, LIU Yueyue, YOU Guojin, LI Shuyun, XIA Jing, HE Xiao, LI Wenwen, DU Lijing, HAN Xinfeng, HUANG Yong. Pathogenicity and epidemiological investigation of outbreaks of fowl adenovirus subpopulation Ⅰ infection in chickens in parts of southwestern China [J]. , 2017, 29(11): 1809-1818.
[12]	CHEN Xianfeng, ZHANG Huili, ZHAO Lei. Isolation and identification of Xanthomonas axonopodis pv. citr on lemon samples from Taiwan [J]. , 2017, 29(1): 101-105.
[13]	ZHU Hai\\|xia， MA Yongqiang, CHENG Liang， GUO Qing\\|yun*. Pathogenicity of Alternaria tenuissima HZ-1 to broadleaf weeds and its safety on crops [J]. , 2016, 28(6): 1037-.
[14]	DU Dan\\|chao， LU Lian\\|ming， HU Xiu\\|rong， HUANG Zhen\\|dong， ZHANG Li\\|ping， CHEN Guo\\|qing*. Isolation and identification of Purpureocillium lilacinum and its pathogenicity against Diaphorina citri [J]. , 2015, 27(3): 393-.
[15]	LIU Mao\\|xin1，2， Li Ling1，2， WANG Jiao\\|yu1,， WANG Yan\\|li1， SUN Guo\\|chang1,. The pathogenicity and infection process of Magnaporthe oryzae and Fusarium graminearum on Zizania caduciflora [J]. , 2014, 26(6): 1546-.