OsMYC2, a key transcription factor in jasmonic acid signaling pathway, regulates the induction and differentiation of embryogenic callus in rice

doi:10.3969/j.issn.1004-1524.2023.05.01

Acta Agriculturae Zhejiangensis ›› 2023, Vol. 35 ›› Issue (5): 973-982.DOI: 10.3969/j.issn.1004-1524.2023.05.01

• Crop Science • Previous Articles Next Articles

OsMYC2, a key transcription factor in jasmonic acid signaling pathway, regulates the induction and differentiation of embryogenic callus in rice

JIANG Yingying¹^,²(), ZHANG Hua², LEI Zhiwei²^,³, XU Heng², ZHANG Heng², ZHU Ying²^,^*()

1. College of Chemistry and Life Science, Zhejiang Normal University, Jinhua 321004, Zhejiang, China
2. State Key Laboratory for Managing Biotic and Chemical Treats to the Quality and Safety of Agro-Products, Research Center for Crop Molecular Breeding at Zhejiang Province, Institute of Virology and Biotechnology, Zhejiang Academy of Agricultural Sciences, Hangzhou 310021, China
3. College of Advanced Agricultural Sciences, Zhejiang A&F University, Hangzhou 311300, China

Received:2023-02-03 Online:2023-05-25 Published:2023-06-01

Abstract

Abstract:

Functional analysis of OsMYC2 in rice regeneration could help to reveal that the role of jasmonic acid (JA) and its signal pathway gene in the induction and differentiation of embryogenic callus. By using the qRT-PCR technology, dynamic analysis of OsMYC2 expression was carried out during the regeneration process of rice callus. Several osmyc2 mutants generated from CRISPR/Cas9 technology, were used to study the biological function of OsMYC2 in rice regeneration. Some marker genes, such as OsERF101, OsBBM2, OsWUS, which might play an essential role in the embryogenic callus formation, was investigated in the callus from osmyc2 mutants and wild type rice Nipponbare. Dynamic analysis showed that OsMYC2 was expressed in the entire rice regeneration stage, including the embryogenic callus formation and somatic embryogenesis. Expression of OsMYC2 in callus cultured in the differentiation medium was higher than that in the induction medium. Loss of function of OsMYC2 leads to much lower efficiency of embryogenic callus formation and somatic embryogenesis. And lower expression of OsERF101, OsBBM2 and OsWUS in the osmyc2 mutant callus compared with the wild type suggested that OsMYC2 regulates embryogenic callus formation and somatic embryogenesis of rice might through the JA signal pathway. These results would provide a theoretical basis for further study on the molecular mechanisms of JA signaling pathway involved in regulation of rice regeneration efficiency.

Key words: OsMYC2, rice regeneration, gene editing, callus differentiation, jasmonic acid signal transduction pathway

CLC Number:

S511

JIANG Yingying, ZHANG Hua, LEI Zhiwei, XU Heng, ZHANG Heng, ZHU Ying. OsMYC2, a key transcription factor in jasmonic acid signaling pathway, regulates the induction and differentiation of embryogenic callus in rice[J]. Acta Agriculturae Zhejiangensis, 2023, 35(5): 973-982.

Figures/Tables 4

Table 1 Oligonucleotide primer sequences used for gene expression analysis

基因号	基因名称	正向引物	反向引物	产物
Gene locus	Gene name	Forward primer(5'→3')	Reverse primers(5'→3')	Product/bp
LOC_Os10g42 430	OsMYC2	CGACGCCATCTCCTACATCA	CTCCTTCTTGAGCGACTCCA	100
LOC_Os08g36 920	OsERF101	CAAGTCCGACACATTGTCTC	CATCAGGTCTTGCAAGCCTT	151
LOC_Os04g32 620	OsERF60	ATGGATCGATCGATGCATGA	TGATCTCTTTCTGTCCACGT	131
LOC_Os11g19 060	OsBBM1	ACAGCTGCAGAAGAGAAGGT	CCAGTATTTAAGGGCAGCCA	113
LOC_Os02g40 070	OsBBM2	GTCTCCGAGCAAGATCATCA	TGGAGAGCTCCATAGTGTTG	106
LOC_Os04g56 780	OsWUS	ACGGAGCAGATCAAGATCCT	CTTGTGGTTCTGGAACCAGT	150
LOC_Os01g63 510	OsWOX5	GCTCATGACATGCTACGTGA	CGAGGTCATACGACTTGAGT	110

Fig.1 Dynamic expression analysis of OsMYC2 in regeneration process of rice A, Expression analysis of OsMYC2 in callus cultured in the induction medium; B, Expression analysis of OsMYC2 in callus cultured in the differentiation medium; C, Phenotype of callus in the differentiation medium.

Fig.2 Genotype and phenotype of wild type rice Nipponbare (NIP) and osmyc2 mutant A, Genomic and protein sequence of OsMYC2 in wild type (NIP) and osmyc2 mutant. The red and green letters in the genomic sequence of OsMYC2 represent insert and deleted nucleotide bases, respectively. The red letters in the OsMYC2 Protein sequence represent different amino acid residue and the number means 55 and 57 amino acid residue from N-terminal of OsMYC2 Protein; B, Callus phenotype at 30 days after differentiation of wild type Nipponbare (NIP) and osmyc2 mutant; C, Expression of OsMYC2 in wild type NIP and osmyc2 mutant callus cultured in the differentiation medium; D, Callus induction efficiency of wild type NIP and osmyc2 mutant; E, Embryogenic callus differentiation efficiency of wild type NIP and osmyc2 mutant; ** represents significant difference at the 0.01 levels (t-test).

Fig.3 Expresssion analysis results of OsERF101 (A), OsERF60 (B), OsWUS (C), OsBBM1 (D), OsBBM2 (E) and OsWOX5 (F) in callus of wild type rice Nipponbare (NIP) and osmyc2 mutant N.S. represents no difference and *, ** represents significant difference at the 0.05 and 0.01 levels (t-test), respectively.

References 37

[1]	SANG Y L, CHENG Z J, ZHANG X S. Plant stem cells and de novo organogenesis[J]. New Phytologist, 2018, 218(4): 1334-1339. DOI URL
[2]	IKEUCHI M, FAVERO D S, SAKAMOTO Y, et al. Molecular mechanisms of plant regeneration[J]. Annual Review of Plant Biology, 2019, 70: 377-406. DOI PMID
[3]	AFLAKI F, GUTZAT R, MOZGOVÁ I. Chromatin during plant regeneration: opening towards root identity?[J]. Current Opinion in Plant Biology, 2022, 69: 102265. DOI URL
[4]	ALTPETER F, SPRINGER N M, BARTLEY L E, et al. Advancing crop transformation in the era of genome editing[J]. The Plant Cell, 2016, 28(7): 1510-1520. DOI PMID
[5]	SUGIMOTO K, TEMMAN H, KADOKURA S, et al. To regenerate or not to regenerate: factors that drive plant regeneration[J]. Current Opinion in Plant Biology, 2019, 47: 138-150. DOI PMID
[6]	TIE W W, ZHOU F, WANG L, et al. Reasons for lower transformation efficiency in indica rice using Agrobacterium tumefaciens-mediated transformation: lessons from transformation assays and genome-wide expression profiling[J]. Plant Molecular Biology, 2012, 78(1): 1-18. DOI URL
[7]	王诗雨, 蒋莹莹, 徐恒, 等. 从水稻再生的研究进展看籼稻遗传转化的未来[J]. 植物生理学报, 2021, 57(11): 2069-2076.
	WANG S Y, JIANG Y Y, XU H, et al. The future of genetic transformation of indica rice: perspectives from the research progress of rice regeneration[J]. Plant Physiology Journal, 2021, 57(11): 2069-2076. (in Chinese with English abstract)
[8]	SKOOG F, MILLER C O. Chemical regulation of growth and organ formation in plant tissues cultured in vitro[J]. Symposia of the Society for Experimental Biology, 1957, 11: 118-130. PMID
[9]	IKEUCHI M, SUGIMOTO K, IWASE A. Plant callus: mechanisms of induction and repression[J]. The Plant Cell, 2013, 25(9): 3159-3173. DOI PMID
[10]	LI Y H, HAN S, QI Y H. Advances in structure and function of auxin response factor in plants[J]. Journal of Integrative Plant Biology, 2023, 65(3): 617-632. DOI
[11]	FAN M Z, XU C Y, XU K, et al. Lateral organ boundaries domain transcription factors direct callus formation in Arabidopsis regeneration[J]. Cell Research, 2012, 22(7): 1169-1180. DOI
[12]	INZÉ D, DE VEYLDER L. Cell cycle regulation in plant development[J]. Annual Review of Genetics, 2006, 40: 77-105. PMID
[13]	HWANG I, SHEEN J, MÜLLER B. Cytokinin signaling networks[J]. Annual Review of Plant Biology, 2012, 63: 353-380. DOI PMID
[14]	RIOU-KHAMLICHI C, HUNTLEY R, JACQMARD A, et al. Cytokinin activation of Arabidopsis cell division through a D-type cyclin[J]. Science, 1999, 283(5407): 1541-1544. DOI URL
[15]	SAKAI H, HONMA T, AOYAMA T, et al. ARR1, a transcription factor for genes immediately responsive to cytokinins[J]. Science, 2001, 294(5546): 1519-1521. PMID
[16]	ZHANG G F, ZHAO F, CHEN L Q, et al. Jasmonate-mediated wound signalling promotes plant regeneration[J]. Nature Plants, 2019, 5(5): 491-497. DOI PMID
[17]	IKEUCHI M, RYMEN B, SUGIMOTO K. How do plants transduce wound signals to induce tissue repair and organ regeneration?[J]. Current Opinion in Plant Biology, 2020, 57: 72-77. DOI PMID
[18]	ZHOU W K, LOZANO-TORRES J L, BLILOU I, et al. A jasmonate signaling network activates root stem cells and promotes regeneration[J]. Cell, 2019, 177(4): 942-956.e14. DOI PMID
[19]	HEYMAN J, COOLS T, VANDENBUSSCHE F, et al. ERF115 controls root quiescent center cell division and stem cell replenishment[J]. Science, 2013, 342(6160): 860-863. DOI PMID
[20]	FONSECA S, CHICO J M, SOLANO R. The jasmonate pathway: the ligand, the receptor and the core signalling module[J]. Current Opinion in Plant Biology, 2009, 12(5): 539-547. DOI PMID
[21]	CAI Q, YUAN Z, CHEN M J, et al. Jasmonic acid regulates spikelet development in rice[J]. Nature Communications, 2014, 5(1): 1-13.
[22]	UJI Y, TANIGUCHI S, TAMAOKI D, et al. Overexpression of OsMYC2 results in the up-regulation of early JA-rresponsive genes and bacterial blight resistance in rice[J]. Plant & Cell Physiology, 2016, 57(9): 1814-1827.
[23]	KONG Y Z, WANG G, CHEN X, et al. OsPHR2 modulates phosphate starvation-induced OsMYC2 signalling and resistance to Xanthomonas oryzae pv. oryzae[J]. Plant, Cell & Environment, 2021, 44(10): 3432-3444.
[24]	HU J L, HUANG J, XU H S, et al. Rice stripe virus suppresses jasmonic acid-mediated resistance by hijacking brassinosteroid signaling pathway in rice[J]. PLoS Pathogens, 2020, 16(8): e1008801. DOI URL
[25]	TAN X X, ZHANG H H, YANG Z H, et al. NF-YA transcription factors suppress jasmonic acid-mediated antiviral defense and facilitate viral infection in rice[J]. PLoS Pathogens, 2022, 18(5): e1010548. DOI URL
[26]	QIU J H, XIE J H, CHEN Y, et al. Warm temperature compromises JA-regulated basal resistance to enhance Magnaporthe oryzae infection in rice[J]. Molecular Plant, 2022, 15(4): 723-739. DOI URL
[27]	UJI Y, AKIMITSU K, GOMI K. Identification of OsMYC2-regulated senescence-associated genes in rice[J]. Planta, 2017, 245(6): 1241-1246. DOI PMID
[28]	SHE K C, KUSANO H, KOIZUMI K, et al. A novel factor FLOURY ENDOSPERM2 is involved in regulation of rice grain size and starch quality[J]. The Plant Cell, 2010, 22(10): 3280-3294. DOI URL
[29]	MATOSEVICH R, COHEN I, GIL-YAROM N, et al. Local auxin biosynthesis is required for root regeneration after wounding[J]. Nature Plants, 2020, 6(8): 1020-1030. DOI PMID
[30]	SHARONI A M, NURUZZAMAN M, SATOH K, et al. Gene structures, classification and expression models of the AP2/EREBP transcription factor family in rice[J]. Plant and Cell Physiology, 2011, 52(2): 344-360. DOI PMID
[31]	JIN Y, PAN W Y, ZHENG X F, et al. OsERF101, an ERF family transcription factor, regulates drought stress response in reproductive tissues[J]. Plant Molecular Biology, 2018, 98(1/2): 51-65. DOI
[32]	KHANDAY I, SKINNER D, YANG B, et al. A male-expressed rice embryogenic trigger redirected for asexual propagation through seeds[J]. Nature, 2019, 565(7737): 91-95. DOI
[33]	ZUO J R, NIU Q W, FRUGIS G, et al. The WUSCHEL gene promotes vegetative-to-embryonic transition in Arabidopsis[J]. The Plant Journal: for Cell and Molecular Biology, 2002, 30(3): 349-359. DOI URL
[34]	KONG X P, LU S C, TIAN H Y, et al. WOX5 is shining in the root stem cell niche[J]. Trends in Plant Science, 2015, 20(10): 601-603. DOI PMID
[35]	KAWAI T, SHIBATA K, AKAHOSHI R, et al. WUSCHEL-related homeobox family genes in rice control lateral root primordium size[J]. Proceedings of the National Academy of Sciences of the United States of America, 2022, 119(1): e2101846119.
[36]	XIA T Y, CHEN H Q, DONG S J, et al. OsWUS promotes tiller bud growth by establishing weak apical dominance in rice[J]. The Plant Journal: for Cell and Molecular Biology, 2020, 104(6): 1635-1647. DOI PMID
[37]	LOWE K, WU E, WANG N, et al. Morphogenic regulators Baby boom and Wuschel improve monocot transformation[J]. The Plant Cell, 2016, 28(9): 1998-2015. DOI URL

OsMYC2, a key transcription factor in jasmonic acid signaling pathway, regulates the induction and differentiation of embryogenic callus in rice

RichHTML

PDF (PC)

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 4

References 37

Related Articles 5

Recommended Articles

Metrics

Comments

[1]	OU Chun, ZHANG Min, DING Lin, YAO Xiamei, WANG Zelu, PENG Cheng, XU Junfeng. Application and policy regulation of CRISPR/Cas9 gene editing technology in plants [J]. Acta Agriculturae Zhejiangensis, 2022, 34(8): 1806-1814.
[2]	LI Lin, ZHU Xueming, BAO Jiandong, WANG Jiaoyu, LIN Fucheng. Gene editing: past and present [J]. Acta Agriculturae Zhejiangensis, 2022, 34(5): 1091-1102.
[3]	LI Hongying, GAO Yanwu, YU Ru’en, WANG Zhengbo, LI Xueping, LIU Longchang. Argonaute2 mutants in Arabidopsis created by CRISPR_Cas9 technology [J]. Acta Agriculturae Zhejiangensis, 2021, 33(11): 2001-2008.
[4]	TAN Xiaojing, WANG Zhonghua, WU Yueyan, ZHENG Ersong, XU Rumeng, CHEN Jianping, WANG Xuming, YAN Chengqi. Application progress of gene editing techniques in rice disease-resistant genes and breeding research [J]. Acta Agriculturae Zhejiangensis, 2021, 33(10): 1982-1990.
[5]	YUAN Wenxia, WANG Xuming, LI Dongyue, ZHOU Jie, YAN Chengqi, CHEN Jianping. Application of the technology of CRISPR/Cas9 edit rice gene [J]. , 2017, 29(5): 685-693.