Cloning and function analysis of JcMBY27 gene from Jatropha curcas

doi:10.3969/j.issn.1004-1524.20240956

Acta Agriculturae Zhejiangensis ›› 2025, Vol. 37 ›› Issue (8): 1658-1665.DOI: 10.3969/j.issn.1004-1524.20240956

• Crop Science • Previous Articles Next Articles

Cloning and function analysis of JcMBY27 gene from Jatropha curcas

WANG Xiaohui(), JIA Sainan, FENG Jiayu, YIN Xinyue, LIU Zixuan, LIU Wenjie, ZHAO Shuaiying, WANG Shujing, TANG Yuehui()

College of Life Science and Agronomy, Zhoukou Normal University, Zhoukou 466001, Henan, China

Received:2024-11-11 Online:2025-08-25 Published:2025-09-03
Contact: TANG Yuehui

Abstract

Abstract:

MYB transcription factors play an important regulatory role in plant growth, development and secondary metabolite synthesis. To investigate the function of the MYB transcription factor gene JcMYB27 in Jatropha curcas, this study used J. curcas as material, and cloned the JcMYB27 gene by reverse transcription polymerase chain reaction (RT-PCR), analyzed its expression patterns using quantitative real-time PCR (qRT-PCR), determined its subcellular localization through transient expression in Arabidopsis thaliana protoplasts, and generated JcMYB27-overexpression Arabidopsis thaliana plants by the floral dip method. Phenotypic analyses were conducted under normal growth conditions, including root hair number and leaf anthocyanin content under 5% sucrose induction. The results showed that the length of JcMYB27 open reading frame was 243 bp, encoding 80 amino acids. Expression pattern analysis showed that JcMYB27 was expressed most highly in J. curcas roots. Subcellular localization analysis demonstrated that JcMYB27 was localized in the nucleus and cytoplasm. Under normal growth conditions, overexpression of the JcMYB27 gene in A. thaliana increased root hair numbers while reducing the anthocyanin content in leaves. Under sucrose induction, JcMYB27-overexpression A. thaliana exhibited significantly lower leaf anthocyanin content compared with wild-type plants. Additionally, the expressions of anthocyanin synthesis-related genes DFR, LDOX and UF3GT in JcMYB27-overexpression A. thaliana were significantly lower than those in wild type. In conclusion, JcMYB27 gene plays a regulatory role in root hair development and anthocyanin biosynthesis in J. curcas.

Key words: Jatropha curcas, JcMYB27 gene, MYB transcription factor, Arabidopsis thaliana, root hair, anthocyanin

CLC Number:

S718.3

WANG Xiaohui, JIA Sainan, FENG Jiayu, YIN Xinyue, LIU Zixuan, LIU Wenjie, ZHAO Shuaiying, WANG Shujing, TANG Yuehui. Cloning and function analysis of JcMBY27 gene from Jatropha curcas[J]. Acta Agriculturae Zhejiangensis, 2025, 37(8): 1658-1665.

Figures/Tables 7

Table 1 The primers used in this study

基因名称Gene name	正向引物序列Forward primer sequences(5'-3')	反向引物序列Reverse primerr sequences(5'-3')
qRT-PCR引物qRT-PCR primers
JcMYB27	GGTTGGAGAGAGGTGGTCGTTA	TCATCTCTCAGTTGATGATGAGCT
DFR	TGGTCGGTCCATTCATCACAACG	CTTGGCGGCTGCTTGTTCGTATA
LDOX	TCTACGAGGGCAAATGGGTCACT	TCCGGCAACGGCTTAAGAACAATC
UF3GT	ATCGAATGAATCGTCAAGCATGAG	TGAGGGATAGAGATGGTGTGGAAAG
CHS	AAGTTGGTCTCACCTTCCATCTCCT	TGTCGCCCTCATCTTCTCTTCCTT
JcActin	TAATGGTCCCTCTGGATGTG	AGAAAAGAAAAGAAAAAAGCAGC
AtActin2	GCACCCTGTTCTTCTTACCG	AACCCTCGTAGATTGGCACA
基因克隆引物Gene coding primers
JcMYB27	GCCATACTTCCCATACCTCTAA	CTGGGTGACTAAACTTCATCTCT

Fig.1 Cloning of JcMYB27 and amino acid sequence and phylogenetic tree of its homologous proteins A. Electrophoresis analysis of JcMYB27 PCR products; B. Amino acid sequence analysis of JcMYB27 and its homologous protein MYB domain; C, Phylogenetic tree analysis; D, Full-length amino acid sequence alignment of JcMYB27 protein and homologous proteins in Arabidopsis thaliana.

Fig.2 Organ-specific expression of the JcMYB27 gene in seedlings of Jatropha curcas

Fig.3 Subcellular localization of JcMYB27 protein in Arabidopsis thaliana protoplasts

Fig.4 Phenotype and root hairs of Arabidopsis thaliana plants A, Expression of JcMYB27 gene; B, Phenotype of 28-day-old Arabidopsis thaliana; C, Root hair phenotype of Arabidopsis thaliana; D, Flowering time of Arabidopsis thaliana; E, Yield per plant of Arabidopsis thaliana. WT, Wild-type Arabidopsis thaliana; OE1, OE2 and OE3, JcMYB27 overexpressing Arabidopsis thaliana.

Fig.5 Phenotype of Arabidopsis thaliana plants and the anthocyanin content in leaves A, Growth status ofArabidopsis thaliana on 1/2 MS medium and 1/2 MS medium containing 5% sucrose; B, Anthocyanin content in leaves of Arabidopsis thaliana under normal growth conditions (1/2 MS medium); C, Anthocyanin content in leaves of Arabidopsis thaliana under 5% sucrose induction (1/2 MS medium containing 5% sucrose). **indicates significant difference compared with the wild type (p< 0.01).

Fig.6 Relative expression levels of anthocyanin biosynthesis-related genes in Arabidopsis thaliana leaves ** indicates significant difference compared with the wild type (p<0.01).

References 14

[1]	OPENSHAW K. A review of Jatropha curcas: an oil plant of unfulfilled promise[J]. Biomass and Bioenergy, 2000, 19(1): 1-15.
[2]	WANG X P, NIU Y L, ZHENG Y. Multiple functions of MYB transcription factors in abiotic stress responses[J]. International Journal of Molecular Sciences, 2021, 22(11): 6125.
[3]	CHEN Z, WU Z X, DONG W Y, et al. MYB transcription factors becoming mainstream in plant roots[J]. International Journal of Molecular Sciences, 2022, 23(16): 9262.
[4]	MA R, LIU B W, GENG X, et al. Biological function and stress response mechanism of MYB transcription factor family genes[J]. Journal of Plant Growth Regulation, 2023, 42(1): 83-95.
[5]	MATSUI K, UMEMURA Y, OHME-TAKAGI M. AtMYBL2, a protein with a single MYB domain, acts as a negative regulator of anthocyanin biosynthesis in Arabidopsis[J]. The Plant Journal, 2008, 55(6): 954-967.
[6]	ZHU H F, FITZSIMMONS K, KHANDELWAL A, et al. CPC, a single-repeat R3 MYB, is a negative regulator of anthocyanin biosynthesis in Arabidopsis[J]. Molecular Plant, 2009, 2(4): 790-802.
[7]	YOSHIDA K, MA D W, CONSTABEL C P. The MYB182 protein down-regulates proanthocyanidin and anthocyanin biosynthesis in poplar by repressing both structural and regulatory flavonoid genes[J]. Plant Physiology, 2015, 167(3): 693-710.
[8]	YANG Q R, YANG X P, WANG L, et al. Two R2R3-MYB genes cooperatively control trichome development and cuticular wax biosynthesis in Prunus persica[J]. New Phytologist, 2022, 234(1): 179-196.
[9]	XU W Q, NYAMAHARO K C, HUANG Y S, et al. A signal R3-type, CAPRICE-like MYB transcription factor from Dendrobium nobile controls trichome and root-hair development in Arabidopsis[J]. Plant Science, 2023, 337: 111878.
[10]	ZHOU L X, YARRA R, YANG Y D, et al. The oil palm R2R3-MYB subfamily genes EgMYB111 and EgMYB157 improve multiple abiotic stress tolerance in transgenic Arabidopsis plants[J]. Plant Cell Reports, 2022, 41(2): 377-393.
[11]	BIAN S M, JIN D H, SUN G Q, et al. Characterization of the soybean R2R3-MYB transcription factor GmMYB81 and its functional roles under abiotic stresses[J]. Gene, 2020, 753: 144803.
[12]	SU J C, ZHAN N, CHENG X R, et al. Genome-wide analysis of cotton MYB transcription factors and the functional validation of GhMYB in response to drought stress[J]. Plant & Cell Physiology, 2024, 65(1): 79-94.
[13]	ZHANG Y Z, XU S Z, MA H P, et al. The R2R3-MYB gene PsMYB58 positively regulates anthocyanin biosynthesis in tree peony flowers[J]. Plant Physiology and Biochemistry, 2021, 164: 279-288.
[14]	NI J B, PREMATHILAKE A T, GAO Y H, et al. Ethylene-activated PpERF105 induces the expression of the repressor-type R2R3-MYB gene PpMYB140 to inhibit anthocyanin biosynthesis in red pear fruit[J]. The Plant Journal, 2021, 105(1): 167-181.

Cloning and function analysis of JcMBY27 gene from Jatropha curcas

RichHTML

PDF (PC)

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 7

References 14

Related Articles 13

Recommended Articles

Metrics

Comments

[1]	LI Yujing, HUANG Qianru, ZHANG Aidong, WU Xuexia, ZHU Dongxing, XIAO Kai. Function of the SmMYB13 gene in drought stress response in eggplant (Solanum melongena L.) [J]. Acta Agriculturae Zhejiangensis, 2025, 37(8): 1666-1679.
[2]	DI Yancui, JI Zelin, WANG Yuanyuan, LOU Shihao, ZHANG Tao, GUO Zhixin, SHEN Shunshan, PIAO Fengzhi, DU Nanshan, DONG Xiaoxing, DONG Han. Identification, subcellular localization and expression analysis of tomato SlMYB52 gene [J]. Acta Agriculturae Zhejiangensis, 2025, 37(4): 808-819.
[3]	YANG Guiren, MU Honglei, WU Weijie, FANG Xiangjun, CHEN Huizhi, NIU Ben, CHEN Hangjun, GAO Haiyan. Research on the process optimization and maintenance of anthocyanins in Chinese bayberry juice by casein [J]. Acta Agriculturae Zhejiangensis, 2025, 37(1): 178-188.
[4]	NIU Yu, LI Jing, WANG Junwen, LI Ruirui, TIAN Qiang, WU Yue, YU Jihua. Research progress of anthocyanin biosynthesis, regulation, bioactivity and detection in higher plants [J]. Acta Agriculturae Zhejiangensis, 2024, 36(4): 978-996.
[5]	HAN Yanchao, CHEN Huizhi, NIU Ben, ZHANG Xiaoshuan, HAN Shuren, WANG Xiaoyan, WANG Guannan, LIU Ruiling, GAO Haiyan. Effect of vibration stress on anthocyanin metabolism and related gene expression in blueberry [J]. Acta Agriculturae Zhejiangensis, 2024, 36(3): 622-633.
[6]	TANG Yuehui, CHEN Shuying, HE Wenqiong, WANG Hanjin, BAO Xinxin, JIA Sainan, WANG Yaoyao, CHEN Yuyang, YANG Tongwen. Cloning and functional analysis of JcERF22 gene from Jatropha curcas [J]. Acta Agriculturae Zhejiangensis, 2024, 36(10): 2219-2228.
[7]	XU Li, WANG Qi, DING Ting, JIANG Teng. Cloning of GRMZM2G455909 gene from maize and its functional analysis in transgenic plants [J]. Acta Agriculturae Zhejiangensis, 2022, 34(9): 1976-984.
[8]	YANG Haijian, ZHANG Yungui, ZHOU Xinzhi, HONG Lin, YANG Lei, PENG Fangfang, WANG Wu. Analysis of anthocyanin synthesis and related gene expression in blood orange peel under different PE materials shading during fruit coloring period [J]. Acta Agriculturae Zhejiangensis, 2021, 33(10): 1861-1869.
[9]	LI Junxia, WANG Chunyi, DING Yutao, DAI Shutao, ZHU Cancan, SONG Yinghui, QIN Na, CHEN Yuxiang. Progress on application of MYB transcription factor in plant salt tolerance genetic engineering [J]. , 2020, 32(10): 1910-1920.
[10]	LIN Yicheng, FU Qinglin, GUO Bin, LIU Chen, DING Nengfei. Effects of salt stress on anthocyanin content and activities of antioxidant enzymes in leaves of Photinia frasery [J]. , 2018, 30(6): 970-977.
[11]	XIA Qile, CAO Yan, CHEN Jianbing, HAN Yanchao, LIU Ruiling. Investigation of improving color stability of bayberry integrated alcoholic beverage [J]. , 2018, 30(10): 1775-1781.
[12]	MIAO Li\\|xiang1， RONG Ning\\|ning1，2， ZHANG Yu\\|chao1， YANG Xiao\\|fang1， ZHANG Qin3， JIANG Gui\\|hua1，*. Preliminary study on molecular regulation mechanism of anthocyanin biosynthesis in strawberry#br# [J]. , 2015, 27(8): 1373-.
[13]	RONG Ningning;MIAO Lixiang;YANG Xiaofang;ZHANG Yuchao;CHENG Jianhui;CHEN Junwei;JIANG Guihua;* . Determination of pelargonidin 3Oglucoside in strawberry by reversed phase high performance liquid chromatography [J]. , 2014, 26(3): 0-626631.